ID: 995443801

View in Genome Browser
Species Human (GRCh38)
Location 5:112220781-112220803
Sequence CAGGGGAAAAAGGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1864
Summary {0: 1, 1: 0, 2: 20, 3: 190, 4: 1653}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995443801_995443812 20 Left 995443801 5:112220781-112220803 CCTTCTTCCTCCTTTTTCCCCTG 0: 1
1: 0
2: 20
3: 190
4: 1653
Right 995443812 5:112220824-112220846 ATCCTGCTTTACCCAGAGGGAGG No data
995443801_995443810 16 Left 995443801 5:112220781-112220803 CCTTCTTCCTCCTTTTTCCCCTG 0: 1
1: 0
2: 20
3: 190
4: 1653
Right 995443810 5:112220820-112220842 AGATATCCTGCTTTACCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 148
995443801_995443811 17 Left 995443801 5:112220781-112220803 CCTTCTTCCTCCTTTTTCCCCTG 0: 1
1: 0
2: 20
3: 190
4: 1653
Right 995443811 5:112220821-112220843 GATATCCTGCTTTACCCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 128
995443801_995443815 22 Left 995443801 5:112220781-112220803 CCTTCTTCCTCCTTTTTCCCCTG 0: 1
1: 0
2: 20
3: 190
4: 1653
Right 995443815 5:112220826-112220848 CCTGCTTTACCCAGAGGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 256
995443801_995443813 21 Left 995443801 5:112220781-112220803 CCTTCTTCCTCCTTTTTCCCCTG 0: 1
1: 0
2: 20
3: 190
4: 1653
Right 995443813 5:112220825-112220847 TCCTGCTTTACCCAGAGGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995443801 Original CRISPR CAGGGGAAAAAGGAGGAAGA AGG (reversed) Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900320668 1:2081936-2081958 CAGGGGACAAATGGGCAAGAGGG - Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900824531 1:4915675-4915697 CAGGGGAAAAATGAAGAACTAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901426372 1:9184141-9184163 GAGGGATAAAAGGAGGCAGATGG + Intergenic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
902094361 1:13930491-13930513 AAAGGGAAAAAGGGGGAAAATGG - Intergenic
902436225 1:16399522-16399544 CTGGTGAAGAAGGAGGCAGAAGG + Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902646926 1:17806045-17806067 GAGGAGGAAAAGGAGGAAGCAGG - Intronic
902786076 1:18733577-18733599 CAGAGGGAAAAGGTGGAGGAGGG + Intronic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
902993147 1:20203709-20203731 CAGTAGAAAGAAGAGGAAGATGG + Intergenic
903352487 1:22726185-22726207 AAGGAGAAAAAGGAGGAAGGAGG - Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903553663 1:24177489-24177511 CACGGGAGAAAGAAGGAAGCTGG + Intronic
903662294 1:24985507-24985529 CATGGGGAGAAGCAGGAAGAGGG - Intergenic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904128691 1:28260121-28260143 GAGGGGGAGAAGGAGGGAGAGGG - Intronic
904314771 1:29653123-29653145 CAGGTGGAAAAGGTGGAGGAGGG - Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904364655 1:30002603-30002625 CTGGGGAATAAGGAAGAAAATGG - Intergenic
904464678 1:30700812-30700834 CAGGGGAAACAGGAGCGAGGGGG + Intergenic
904565236 1:31424798-31424820 CAGGGTGAAAAAGAAGAAGAAGG - Exonic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905173467 1:36122745-36122767 CTGGGGAACAAGGATGAAGGGGG - Intronic
905321258 1:37119090-37119112 CAGGGGAAGAAGGGACAAGAGGG + Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
905863772 1:41366172-41366194 CGGAGGACAAAGGAGGAGGAGGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906228044 1:44138284-44138306 GGGGGGAATAAGGAGGATGAGGG + Intergenic
906395357 1:45458889-45458911 CATGGAAAAAAGTAGAAAGAGGG - Intronic
906516708 1:46443312-46443334 GAGGAGGAGAAGGAGGAAGAGGG - Intergenic
906516740 1:46443433-46443455 GAGAAGGAAAAGGAGGAAGAAGG - Intergenic
906516746 1:46443467-46443489 GAGAAGGAAAAGGAGGAAGAAGG - Intergenic
906562652 1:46770507-46770529 CAGGGGAAAAGGGTGGAGGGTGG - Intronic
906910982 1:49950400-49950422 CAGGGGGAAAGGGAGGGAAAAGG + Intronic
907338489 1:53716281-53716303 CAGGGGGAGAGGGAGGCAGAGGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908068849 1:60436351-60436373 CAGGCGAGAAAGAAGGAAAATGG - Intergenic
908123127 1:61004547-61004569 CAAGGCAAAAGGGAGAAAGAGGG + Intronic
908162654 1:61426283-61426305 CAGTCAAAAAAGGGGGAAGAGGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908469481 1:64429532-64429554 CAGGGAAGCAAGGAAGAAGAAGG - Intergenic
909033877 1:70574554-70574576 AAGTGGTAAAAGGAGGAAGGAGG - Intergenic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910799771 1:91133422-91133444 CAGGAGAAAAAGGAGGGGAAAGG - Intergenic
910843028 1:91578950-91578972 CTGGGGAGAAAGGAGGCAGAAGG - Intergenic
910985907 1:93004284-93004306 AAAGAGAAATAGGAGGAAGATGG - Intergenic
910987180 1:93016841-93016863 GAGGTGGGAAAGGAGGAAGAAGG - Intergenic
911154675 1:94626091-94626113 TAGGGAAAGAAGGAGAAAGAGGG + Intergenic
911314488 1:96339586-96339608 CAGAGGAAAAGAGAGGAGGAAGG - Intergenic
911471571 1:98325652-98325674 CATTTGAAAAAGAAGGAAGAAGG - Intergenic
911734070 1:101318154-101318176 CGGGGGAGAAAGGCAGAAGAAGG - Intergenic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
911992128 1:104712154-104712176 GAGGGGAAGACAGAGGAAGAAGG - Intergenic
912040839 1:105388042-105388064 CAGGGCAAAAAGGTGGAATCTGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912095491 1:106137129-106137151 CAGAAGAAGAAGGAGAAAGAGGG + Intergenic
912161664 1:106992980-106993002 CAAGGGAGAAGGGAGGGAGACGG + Intergenic
912227975 1:107757845-107757867 CAGGGGAAAAAAGAGGACTAGGG - Intronic
912446055 1:109737644-109737666 CCGGGGAAAAGGTAGGAAGAAGG - Exonic
912503407 1:110137461-110137483 CATGGGGAAAAGGGTGAAGAAGG - Intergenic
912581262 1:110723016-110723038 CAGGGAAGAAATGAGTAAGAAGG - Intergenic
912696929 1:111848911-111848933 CAGGGGAAAAGGGAAGAGCAAGG - Intronic
912698813 1:111861146-111861168 AAGGGCAGAAAGGAGGAAGGGGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
912805471 1:112753253-112753275 AAGGAAAGAAAGGAGGAAGAAGG - Intergenic
913027016 1:114854117-114854139 GAGGAGAGAAAGGAGGCAGAGGG - Intergenic
913409482 1:118535458-118535480 CAGGTGAAGAAGGACGAAGTTGG + Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
913988337 1:143585697-143585719 GAGGGGAAAAAGCAGACAGAAGG + Intergenic
914843031 1:151264082-151264104 CAGGGGAGAAATGAGTATGATGG - Intronic
914905697 1:151741760-151741782 CAGGGGAAGAAGCAGGCAGCTGG - Intergenic
915520249 1:156437615-156437637 CAGGAGAACAGGGAGCAAGAGGG + Intergenic
915690370 1:157682879-157682901 GAGTGGAAGAATGAGGAAGAAGG + Intronic
915731260 1:158056076-158056098 CAGGGCAGAAGGGAGGAAGCAGG - Intronic
915864223 1:159481112-159481134 CAAAGTCAAAAGGAGGAAGACGG + Intergenic
915885367 1:159715961-159715983 AAAGGGAAAAAGGGGGAAGTGGG - Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916204068 1:162298280-162298302 CATGGGAAACGGGAGCAAGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917336855 1:173932570-173932592 AAGAGGAAAAAGGATGAACAGGG + Exonic
917410609 1:174756642-174756664 CAGGGGAAAAAGGAAGGCGGAGG + Intronic
917601568 1:176579271-176579293 AACAGGAAAAAGGAGGAAGTGGG + Intronic
918106416 1:181419199-181419221 CAGGGGGAAGAGGGAGAAGATGG - Intronic
918158184 1:181871570-181871592 TAGGGGGAAAAGGTGGGAGAAGG + Intergenic
918431779 1:184468401-184468423 GGGGGAAAAAAGGAGGAAGGTGG + Intronic
918595410 1:186287208-186287230 AAGGGGAAAAAAGATGAAGATGG - Intergenic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919411998 1:197257239-197257261 CAGAACAAAAAGGTGGAAGAAGG - Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919849774 1:201664840-201664862 CAGGGGAAAAGGGAGGAGATGGG - Intronic
919919061 1:202157597-202157619 CAGCAGAGAAAGGGGGAAGAAGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920073610 1:203321237-203321259 TAGGGGACGAGGGAGGAAGAAGG + Intergenic
920077218 1:203346170-203346192 CAGGGGAGAAAGGAATGAGAGGG + Intronic
920100767 1:203515720-203515742 CAGGGGAGAAAGGTGGAGGTGGG + Intergenic
920420150 1:205827696-205827718 CAAGGGAAAGTGGAGGAGGAGGG - Intergenic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920556791 1:206909883-206909905 CACGGGAAGAGGGAGGAAAATGG + Intronic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
920813411 1:209308156-209308178 GATTGGAGAAAGGAGGAAGATGG + Intergenic
921117804 1:212110928-212110950 CTGGGGAAGAAGGAGAAAGGAGG - Intergenic
921265719 1:213419085-213419107 CAGGGGGACATAGAGGAAGAAGG - Intergenic
921415128 1:214877214-214877236 CAGGGGAGAAAGATGGGAGAAGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921572773 1:216798462-216798484 CAAGGGAAAGAGGATGAAAAAGG + Intronic
921599130 1:217088871-217088893 GAGGGGTAGAAGGAGGTAGATGG + Intronic
921628980 1:217411053-217411075 CAGAGGCAAAAGGAGAAAGAGGG - Intergenic
921756675 1:218864707-218864729 GAGGGGAGAAAGTATGAAGAAGG - Intergenic
921842768 1:219846282-219846304 CAGGAGGATTAGGAGGAAGATGG + Intronic
921924069 1:220697406-220697428 CTGGCGAGGAAGGAGGAAGAAGG + Exonic
921934533 1:220785063-220785085 CAAAGGAAAATGGAGGAGGAGGG - Intergenic
921963537 1:221062695-221062717 TAGAGGAAAAAGGAGGCAGAGGG - Intergenic
921963693 1:221064804-221064826 GAGGGGAAGGAAGAGGAAGAAGG - Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922209486 1:223476670-223476692 AAGGAGGAGAAGGAGGAAGATGG + Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
922447401 1:225709047-225709069 CAGAGGAATAAAGGGGAAGATGG + Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922945924 1:229513949-229513971 TAGGGGAGAAGGGTGGAAGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923295000 1:232585653-232585675 AAGAGAACAAAGGAGGAAGAAGG + Intergenic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
924020270 1:239773713-239773735 CAAGGGAAATAAGATGAAGATGG + Intronic
924063951 1:240205388-240205410 CAGATGAAAAGAGAGGAAGAAGG - Intronic
924275128 1:242378348-242378370 CTAGGGAAAAAGGAGGAATGGGG + Intronic
924280131 1:242428787-242428809 CAGGAGATAAAGGAACAAGAAGG + Intronic
924643159 1:245852667-245852689 GAGGGGAAAATAGAGAAAGAGGG - Intronic
924794726 1:247285079-247285101 GTGGGGAAAAAGGGAGAAGATGG - Intergenic
924802450 1:247337423-247337445 GAGGAGGAGAAGGAGGAAGAGGG + Intergenic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
924952193 1:248895372-248895394 AAGGACAAAGAGGAGGAAGAAGG + Intergenic
1063158988 10:3406062-3406084 CAGGGGAGAAAGGTAGAAAAAGG - Intergenic
1063538457 10:6908653-6908675 TAGGAGAGAAGGGAGGAAGAAGG - Intergenic
1063591539 10:7400220-7400242 CAGCGGTAGAGGGAGGAAGAGGG + Intronic
1064249287 10:13694464-13694486 CAGGCAGATAAGGAGGAAGAGGG - Intronic
1064850850 10:19707100-19707122 GAGGAGGAAAAGGAAGAAGAAGG - Intronic
1064947686 10:20809846-20809868 CAGGGGATCAAGGTCGAAGATGG + Exonic
1065167069 10:22990922-22990944 CCGGGGAAAAAGGTGGAGGGAGG - Intronic
1065185292 10:23164978-23165000 AAGAGGAAAAGGGAGGAAGAAGG + Intergenic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065790264 10:29254185-29254207 GAGGAGGAGAAGGAGGAAGAAGG + Intergenic
1065890766 10:30119241-30119263 CAGGGGAAAAGGCAGGAGGGAGG + Intergenic
1065916592 10:30358524-30358546 GAAGGGAAAGGGGAGGAAGATGG - Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1066473361 10:35720811-35720833 GAGGGAAAGAAGGAAGAAGAGGG - Intergenic
1066532246 10:36353484-36353506 CATGGGGAAAGGGAGGAAGCAGG + Intergenic
1067061669 10:43081023-43081045 GATGGGAAAAATGAGGAGGAAGG - Intronic
1067902113 10:50253046-50253068 CAAGGGAGAAAGGTGGGAGAAGG - Intergenic
1067934979 10:50602490-50602512 CAGGGGAAGAAGGGAGAAGAAGG + Intronic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068022325 10:51600949-51600971 AAGATGAAGAAGGAGGAAGAAGG + Intronic
1068067872 10:52154791-52154813 CAGGGGAGAAGGGTGGAAGTGGG - Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068199656 10:53766575-53766597 CAGGGAAAAAAGAAGTAATATGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068262456 10:54600246-54600268 CAGGAGAAAGAGGAGAAAGTGGG + Intronic
1068809664 10:61241764-61241786 CAGGTGAAAAAGAACGAAAAAGG - Intergenic
1068843686 10:61646478-61646500 TAGGGGAAAAGGGAGAAATAAGG - Intergenic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1068944798 10:62719016-62719038 AAGGGGAAAAAGGGGAAAAACGG - Intergenic
1069113399 10:64474396-64474418 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
1069824818 10:71248419-71248441 CAGGGGAAGAAGGGGAAAGTGGG - Intronic
1069943820 10:71972802-71972824 CAAGGGGAAAAGGGGGAAGGAGG - Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070326137 10:75390445-75390467 GATGAGAAGAAGGAGGAAGAGGG - Intergenic
1070368277 10:75757290-75757312 CAGGGGAAGAAGGAGGATTTAGG + Intronic
1070610950 10:77932080-77932102 CAGGAGGAAAACGAGGCAGATGG - Intergenic
1071013305 10:80964371-80964393 CAGGGGAGAAGGGTGGGAGAAGG + Intergenic
1071168901 10:82840339-82840361 TAGGAGAAAAAGGATCAAGATGG - Intronic
1071441609 10:85702880-85702902 GAAGGAAAAGAGGAGGAAGACGG + Intronic
1071497565 10:86179319-86179341 CAGGAGAGCAAGGAGAAAGATGG - Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071877800 10:89861454-89861476 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072069136 10:91899738-91899760 CAGGGCAAGTAGGAGGAAGGAGG - Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072181443 10:92985077-92985099 ATGGGGCAAAAGGAGGAAGAGGG - Intronic
1072224534 10:93356191-93356213 CGGGGGAAAAAGCAGGCAGGTGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072524493 10:96259367-96259389 CAGGGGAAATGGGAAGGAGAGGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072797193 10:98365112-98365134 GAAGAGAAAAAGGAGGGAGAAGG + Intergenic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073101180 10:101007479-101007501 CAGGGGAGCAGGGAAGAAGAAGG + Exonic
1073134306 10:101211621-101211643 AAGGGAAAGAAGGAGAAAGAAGG + Intergenic
1073146703 10:101285976-101285998 CAAGGGAAAGAGGAGGCAGAGGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073340116 10:102737937-102737959 CAGGGGAAAAAAGTGAAAAAGGG + Exonic
1073340906 10:102743962-102743984 GAAGGGAAGAAGGAAGAAGAGGG + Exonic
1073371645 10:102995153-102995175 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371652 10:102995171-102995193 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073597699 10:104817353-104817375 AAGGGGAGAAGGGTGGAAGAGGG - Intronic
1073634902 10:105187625-105187647 CAGAGGAAAAAGGAGGCATGGGG + Intronic
1074193431 10:111157996-111158018 AAGGGGAGAAAAGAAGAAGATGG - Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1075139194 10:119816302-119816324 AAGAGGAAAATGTAGGAAGAAGG - Intronic
1075661894 10:124203145-124203167 CAGAGGAAAAGGGAGCAAGATGG - Intergenic
1076019372 10:127058576-127058598 AAGGCAAAAAAGGAGGAAAAGGG - Intronic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1076682114 10:132178345-132178367 AAGGGGGTAGAGGAGGAAGAGGG + Intronic
1077100083 11:818821-818843 CAGGAGAAAAATGCGGAAAAGGG + Intergenic
1077531325 11:3096995-3097017 AAGAGGAAAGAGGGGGAAGACGG + Intronic
1077531350 11:3097084-3097106 AAGAGGAAAGAGGGGGAAGATGG + Intronic
1077563784 11:3283287-3283309 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077569674 11:3329104-3329126 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077787796 11:5403289-5403311 CACTGGAGAAGGGAGGAAGAAGG + Exonic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078155595 11:8797457-8797479 AAGGGGAAGAAAGGGGAAGAAGG - Intronic
1078531919 11:12143184-12143206 CAGGCAGAAAAGGAGGCAGACGG + Intronic
1078593369 11:12665212-12665234 GAGGAGGAAGAGGAGGAAGAAGG + Intergenic
1078612930 11:12837669-12837691 GAAGGGAGAAAGAAGGAAGAAGG - Intronic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079400757 11:20104587-20104609 AGGGGGAAAGAGGAGGACGATGG - Intronic
1080099557 11:28443819-28443841 CAGGGGAACAATGATGAAGGTGG - Intergenic
1080120253 11:28668553-28668575 CAGGAGAAATAGGAGGAAATAGG - Intergenic
1080268103 11:30422644-30422666 GAGGGGGGAAAGGAGGAGGAGGG + Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080498990 11:32850281-32850303 CAGGGGAAAAAAAAGGTAAAAGG - Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080685938 11:34514777-34514799 CAGTGGCAAAAGGAGGAAGTGGG + Intergenic
1080721731 11:34855814-34855836 CAGGGAAATAAGGAGCAAAATGG - Intronic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081008329 11:37775452-37775474 CAAGAGAAAAATGAGGAAGAAGG + Intergenic
1081372207 11:42317623-42317645 CAGGGGAAAAAAAAGAAAGTAGG - Intergenic
1081567759 11:44270381-44270403 CAGGAGAAGAAGGAGGGAGGAGG - Intronic
1081761961 11:45582879-45582901 CAGCAGAAATAGGAGGAAGGTGG - Intergenic
1082069905 11:47930913-47930935 GAGTTGAAGAAGGAGGAAGAAGG - Intergenic
1082085545 11:48046698-48046720 CAGGGGAAAATGTAGTAACATGG - Intronic
1082738278 11:56881744-56881766 CAGGAGGAAAAGGATGAAGAGGG - Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1083021414 11:59511213-59511235 CAGAGAAAAAATGAGAAAGAGGG + Intergenic
1083429965 11:62609169-62609191 CAAGGGCAGGAGGAGGAAGAGGG + Intronic
1083475452 11:62912410-62912432 CTGGGGCAAAAGCAGGAAGCAGG + Intronic
1084207783 11:67606047-67606069 CAGGGGAAAACCGAGGGAGGGGG + Intronic
1084495616 11:69501469-69501491 GAGGGCTGAAAGGAGGAAGATGG + Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1084659776 11:70539974-70539996 CAGGCGAAGATGGAGGCAGAGGG - Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085034617 11:73292606-73292628 CAGGGGAAAGAGGGGGATGGGGG - Intronic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085474138 11:76778948-76778970 CAGGGGAAAAAGCATGGAGGTGG + Intergenic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1086124722 11:83338698-83338720 CAGGGGAGAAAGGTAGGAGAAGG - Intergenic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086794424 11:91083072-91083094 CAAGAGAAAAATGAGGAAGAAGG - Intergenic
1086802635 11:91195893-91195915 CAGGAGACAAAGGAGCAAAAGGG - Intergenic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1087056196 11:93938893-93938915 CAGGGGCAAAGGGAGGAAGCAGG - Intergenic
1087076989 11:94134662-94134684 GAGGGAGAGAAGGAGGAAGAGGG - Intronic
1087138898 11:94746561-94746583 CAGGGGAGAAAGGGAGAAGGGGG - Intronic
1087236406 11:95723746-95723768 CAGGGGAAGATGCAGCAAGAAGG - Intergenic
1087261780 11:96020238-96020260 GAGGGGAAAAAGCAGCAAAAGGG - Intronic
1087461410 11:98453417-98453439 CGGGGGAGCAAGAAGGAAGATGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087605652 11:100374399-100374421 CAGATGAAAGAGGATGAAGAGGG - Intergenic
1087666324 11:101053513-101053535 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666353 11:101053600-101053622 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1088340373 11:108758716-108758738 AAGTGGAAACAGGAGGCAGAAGG - Intronic
1088365780 11:109038565-109038587 CAGGGGAAAAAGGAAAAACATGG - Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088646342 11:111919566-111919588 GAAGGGGAAAGGGAGGAAGAGGG - Intronic
1088678337 11:112217963-112217985 AAGGGGGGCAAGGAGGAAGAGGG + Exonic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088910990 11:114192457-114192479 CAGGGGACTAAAGTGGAAGAAGG + Intronic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089076903 11:115745598-115745620 GAGGGGAAAAAGGAGGACCCAGG + Intergenic
1089111742 11:116062723-116062745 CAGGGGAGAGAGGAGGAAACGGG + Intergenic
1089165470 11:116472788-116472810 CAGGGGAGGAGGGAGGGAGAAGG - Intergenic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1089443811 11:118535627-118535649 TAGGGGAACATGGAGAAAGAAGG + Exonic
1089470521 11:118716706-118716728 AAGGGGAAAAAGCAGGCAGGAGG - Intergenic
1089759879 11:120715556-120715578 GAGGGGAAAGAGGAGAGAGAGGG - Intronic
1090476259 11:127023863-127023885 GAGGGGAAAAGGGAGGCAGCAGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090640457 11:128725294-128725316 CAGGAGAAAGGGGAGGAAGCGGG - Intronic
1090716814 11:129438442-129438464 CAGGCAAAAGAAGAGGAAGAAGG - Intronic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1091074183 11:132599367-132599389 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074185 11:132599377-132599399 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074187 11:132599387-132599409 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074189 11:132599397-132599419 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074191 11:132599407-132599429 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091116478 11:133018368-133018390 GAGGGGAAAAAGAAGTAAAAAGG - Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091446460 12:546528-546550 GAGAGAAAAAGGGAGGAAGACGG - Intronic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1091603128 12:1929918-1929940 GAGGGGGAGGAGGAGGAAGAGGG + Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1091652909 12:2323098-2323120 CAGGGAAGGAAGGAGGAAGGCGG - Intronic
1092116755 12:6014378-6014400 CAGGGGACAAAGGTGGAAGCTGG + Intronic
1092226908 12:6753462-6753484 AAGGGGAAACTGGAGGACGAGGG + Exonic
1092228527 12:6764443-6764465 CAGGAAAAATAGGAGGAAGGTGG + Intronic
1092256112 12:6927746-6927768 GATGGGAGAAGGGAGGAAGAGGG - Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092279549 12:7089205-7089227 CAGGGGATCCAGGAGGAAGTTGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092511172 12:9158345-9158367 CAGGGGTGAAGGGAGGAAGGAGG - Intronic
1092749922 12:11709228-11709250 CAGGGGTAGAATGAGGAAGAAGG - Intronic
1092858707 12:12699661-12699683 GAGGGGAAAAGGGAGAAAGAAGG + Intergenic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093508397 12:19896755-19896777 AGGAGGAAGAAGGAGGAAGAAGG - Intergenic
1093572241 12:20679812-20679834 ATGGGGAAAAAAGAGGAAGATGG - Intronic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094162739 12:27408741-27408763 CAGGGCAATAAGGAAGGAGAAGG + Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095309988 12:40687413-40687435 GAGGGAAAAAAGGAGGGTGAGGG - Intergenic
1095544471 12:43348564-43348586 CAGAGGAAAAAGGAGTCAGAAGG + Intergenic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1095695481 12:45139013-45139035 CATGAGAGAAAGGAGGAGGAAGG - Intergenic
1095950278 12:47778052-47778074 CAAGGGACAAATGAGGAAGGAGG - Intronic
1095985675 12:47997895-47997917 CAGGGGAACAAGGACCCAGAGGG - Exonic
1096182537 12:49558597-49558619 CAGGGGAAACAGGCCGGAGAGGG + Intronic
1096190508 12:49614800-49614822 CAGAGGAAAAAGTGGGAAGCGGG + Intronic
1096300827 12:50425899-50425921 CAGGGGAAGAAGGAGGAAATGGG - Intronic
1096585257 12:52615740-52615762 CAGGGGAGAAAGAAGGCACATGG + Intronic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096692996 12:53332738-53332760 AAGGGGGAGGAGGAGGAAGAAGG + Intronic
1096785100 12:54012818-54012840 CAGGGGGATAAGGAGAGAGAAGG - Intronic
1096849449 12:54426398-54426420 GGGGAGAAAAAGGAGGGAGAAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097282660 12:57854250-57854272 AAGGGGAGGAAGGAGGAAGAAGG + Intergenic
1097426633 12:59453787-59453809 CAGGAGAAAGAGCAGGAATAAGG + Intergenic
1097957994 12:65506101-65506123 TAAGGGAAAAAGGAGGAAACAGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098188846 12:67926540-67926562 CAGGAGAACTAGGAGGAAGCTGG - Intergenic
1098303235 12:69075819-69075841 CAGGGGGAAGAGGAGGATAATGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099508855 12:83509141-83509163 AAGGGGATAACGCAGGAAGAAGG + Intergenic
1099670934 12:85691121-85691143 AAGAGGACAAAGGTGGAAGAAGG + Intergenic
1099712248 12:86242684-86242706 GAGGGAAAAATGGAGGAAGGGGG + Intronic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100456692 12:94758584-94758606 CAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1100546061 12:95603721-95603743 AAAGGGAAGAAGTAGGAAGAAGG - Intergenic
1100979570 12:100153915-100153937 AAAGGGAAAGGGGAGGAAGATGG - Intergenic
1101010101 12:100440711-100440733 GAGGGAGGAAAGGAGGAAGAAGG - Intergenic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1101391000 12:104300316-104300338 AAGAGGAAAAAGGGGAAAGAGGG + Intronic
1102009512 12:109609587-109609609 CATGGGAACAGGGAAGAAGAGGG + Intergenic
1102215417 12:111158148-111158170 CAGGTGAAAACGGAGGATCAGGG + Intronic
1102230251 12:111257257-111257279 AAGAGGAAAAGGGAGGAGGAGGG - Intronic
1102396247 12:112588805-112588827 CAGTGGACATAGGAGGCAGATGG + Intronic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102796909 12:115696722-115696744 CAGGGCAAAAGTGAGCAAGACGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1102990468 12:117311997-117312019 CAGTGGAAAAAGTAGGAGGTAGG + Intronic
1103037339 12:117667198-117667220 CAGGGGAAAGAGCAGGAACTGGG + Intronic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1103450110 12:121022724-121022746 CAGAGGACAAAGGATGATGAGGG - Intronic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1104009118 12:124916625-124916647 AGGAGGAAAAAGGAAGAAGAGGG + Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104578337 12:129989153-129989175 CAGGGGAGAATGGAGGGAGAGGG + Intergenic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1105934408 13:25085926-25085948 CAGGGGACAGAGGAGAGAGAAGG - Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106088845 13:26568249-26568271 CAGGGGACAAAGGTAGAAGGTGG + Intronic
1106175984 13:27332090-27332112 CACAGGAATGAGGAGGAAGAGGG + Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1106653985 13:31722570-31722592 AAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107149101 13:37091287-37091309 CATGGGAAAAAGGAAGAAGAGGG + Intergenic
1107167869 13:37303952-37303974 CAGTGGAAAATGAAGAAAGAAGG - Intergenic
1107229568 13:38091830-38091852 AAAGGGAAAACAGAGGAAGAAGG + Intergenic
1107302318 13:38978474-38978496 GAAGGGAATAAGGAGGAACAAGG - Intronic
1107361623 13:39624590-39624612 CAGGGGAGAACCAAGGAAGAAGG - Intergenic
1107615708 13:42164990-42165012 GAAGGGGAAAAGGAAGAAGAAGG - Intronic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107794331 13:44034460-44034482 GAGAGGGAGAAGGAGGAAGAAGG + Intergenic
1107999667 13:45894706-45894728 CAGAGGAAGATGGCGGAAGATGG - Intergenic
1108225859 13:48287988-48288010 GAGGGGAAAAGGGAGAAAGGGGG + Intergenic
1108248203 13:48538860-48538882 AACAGGAAAAAGGAGGGAGAAGG - Intergenic
1108291034 13:48961370-48961392 GAGAAGAAGAAGGAGGAAGAGGG + Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1109021741 13:57104633-57104655 AAGTGGAAAAGAGAGGAAGAAGG + Intergenic
1109147692 13:58801808-58801830 GAAGGGAAAAGGAAGGAAGAAGG + Intergenic
1109168982 13:59073015-59073037 CAGGGGAGAAAGGTGGAAAAGGG - Intergenic
1109219259 13:59624963-59624985 CAGGGGAGAAGGGTGGGAGAAGG + Intergenic
1109273903 13:60283356-60283378 TAGGAGAAAAAGGCTGAAGAAGG - Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109819626 13:67636257-67636279 CAGGGGACAAAGTTGCAAGATGG + Intergenic
1109900700 13:68765727-68765749 CAGGGGAAATGGGAAGATGATGG + Intergenic
1109994319 13:70103420-70103442 GTGGGGAAAAAGGAGAATGAGGG + Intronic
1110010891 13:70332028-70332050 CAGGGGAGAAAGATGGAAGCCGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110700560 13:78542842-78542864 AAAGGGAAAAAGAAGGAAAAAGG + Intergenic
1110844586 13:80179821-80179843 CAGGGGAGAATGGTGGAGGAAGG - Intergenic
1111000261 13:82169736-82169758 CAGGGAAAAAGGGAGGAAGTAGG + Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111396354 13:87672948-87672970 GAAGGGAAAACGGAGGAAGAAGG - Intronic
1111639159 13:90946353-90946375 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1112006820 13:95260588-95260610 AAGAAGACAAAGGAGGAAGAAGG + Intronic
1112069844 13:95837429-95837451 CCTGGGAACAAGGATGAAGAAGG + Intronic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1112236301 13:97640917-97640939 CATGAGAAAAAGTAGGATGATGG - Intergenic
1112298601 13:98210482-98210504 CAGGGCAGAAGGGAGGAAGTAGG - Intronic
1112567959 13:100567424-100567446 CAATGGAATAATGAGGAAGATGG - Intronic
1112629180 13:101141644-101141666 GAGGTGAAAAAGGAGGAAAAAGG + Intronic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1112664258 13:101551491-101551513 CTGGAGAAAAGGGAGCAAGATGG + Intronic
1112765481 13:102737519-102737541 CAAGGGAAAGAGGACGGAGAAGG - Exonic
1112984785 13:105434864-105434886 CAGGTGAAAAATGAGCATGAGGG - Intergenic
1113060309 13:106315204-106315226 CAGGAGAGAAAGGGGGCAGAGGG - Intergenic
1113129822 13:107023484-107023506 CAAGGGCAAGAGGAGGATGAAGG - Intergenic
1113325399 13:109276778-109276800 CAGGGGAGAATGGTGGAAGAAGG - Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1113957718 13:114108157-114108179 CAGGGGATGACGGAGGATGATGG - Intronic
1114134370 14:19830211-19830233 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114359890 14:21959747-21959769 GAAGGGAAAAGGGAGAAAGAGGG - Intergenic
1114404114 14:22438958-22438980 AAAGGGAAAAAGGAAGAAGAGGG + Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114479706 14:23025143-23025165 CAGGGGATAGAGGAGGTTGATGG - Intronic
1114530966 14:23396264-23396286 CAGGTGAGACAGGAGGAAAAGGG - Exonic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114675439 14:24437100-24437122 CAGGGGAGAGAAGAGGAAAAAGG + Exonic
1114706671 14:24734327-24734349 CAGGAGAAAAGAGAGGGAGATGG - Intergenic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1114760659 14:25310155-25310177 CAGGGGGAAAGGTAGGAAAAGGG + Intergenic
1115348904 14:32371970-32371992 AAGGAGAGAAGGGAGGAAGAGGG - Intronic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116660493 14:47704467-47704489 CAGGGGAGAAAAGAGGATGGGGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117134557 14:52721656-52721678 CAGGGGAAAAAAAAAGAAAAGGG + Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1117669977 14:58096682-58096704 GAGGGGAGAAGGGAGGAAAAGGG + Intronic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117796449 14:59399032-59399054 CTGAAGAAAAGGGAGGAAGAGGG - Intergenic
1117916916 14:60687448-60687470 CAGGGCAAGAAGGAGAAAGAAGG + Intergenic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118770092 14:68937049-68937071 CAAGGGAAAAAGGAAGGAGGAGG - Intronic
1118860082 14:69656144-69656166 GAGGGAAGAATGGAGGAAGACGG - Intronic
1118952283 14:70445825-70445847 CAGAGGACAGAGGAGGAAAAAGG + Intergenic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119180390 14:72601062-72601084 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1119276589 14:73362379-73362401 GAGGGAAAAGAGGAGGAAAAGGG + Intronic
1119850161 14:77861293-77861315 AAGGGGGAGGAGGAGGAAGAGGG - Intronic
1119884646 14:78130079-78130101 TAGGTGAAAAGGGAGGAAGAGGG - Intergenic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1120878226 14:89394005-89394027 CATGGGATAATGGAGCAAGAAGG - Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121588710 14:95082694-95082716 GAGGGGAAAAGGGTGGAAGCAGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121697103 14:95922598-95922620 CATGGGAAAAAGGCAGAACACGG - Intergenic
1121908543 14:97768766-97768788 AAGGGGTGAAAGGAGGAAGGAGG + Intergenic
1121963323 14:98281484-98281506 AGGGGGCAAAAGCAGGAAGAGGG - Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122117512 14:99535244-99535266 CAGTGGGAAAAGCAGGGAGAGGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122322269 14:100862189-100862211 GAGGACAAAAAGGAAGAAGAGGG - Intergenic
1122527309 14:102396542-102396564 TTGGGGAAAATGGTGGAAGAGGG + Intronic
1122581563 14:102775021-102775043 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1123194896 14:106606687-106606709 CAGGTGAAAAGGGAGGAGGGAGG + Intergenic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123577427 15:21685802-21685824 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123614050 15:22128272-22128294 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123715072 15:23022258-23022280 CAGGGCAAAATGGAGGACGGTGG + Intronic
1124121640 15:26893682-26893704 CAGGGGAAACAGGAGGATCTGGG + Intronic
1124490271 15:30151093-30151115 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124753262 15:32387236-32387258 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1124971975 15:34496588-34496610 GAAAGGAAAGAGGAGGAAGACGG - Intergenic
1124975002 15:34522936-34522958 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1125031441 15:35079620-35079642 CAAGAGAAAAAGGAGGAGAAAGG + Intergenic
1125125653 15:36217093-36217115 TAGGAGAAAAAGGAGATAGAGGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125423257 15:39525673-39525695 CAGGGCAAATATGAGGAAGGAGG + Intergenic
1125634147 15:41173067-41173089 AAGGGGAAAGTGGGGGAAGAAGG - Intergenic
1125635878 15:41188318-41188340 GAGGGGGAAGAGGAGGGAGAGGG - Intronic
1125983923 15:44030710-44030732 AAGGTGAAGGAGGAGGAAGATGG + Intronic
1126039853 15:44579221-44579243 CATAAGAAAAAGCAGGAAGAGGG + Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126373570 15:47972068-47972090 CAAGAGACAGAGGAGGAAGAAGG - Intergenic
1126674878 15:51152440-51152462 AAGAGGAAGAAGGAAGAAGAAGG + Intergenic
1126739880 15:51766835-51766857 TAGGGGAAAAAGAAGGAAAGAGG + Intronic
1126742733 15:51794303-51794325 CAGTGGAAAAGACAGGAAGAAGG - Intronic
1127315273 15:57788954-57788976 AAGGGGAAGAAAGAGAAAGAGGG - Intergenic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1127392957 15:58521665-58521687 GAGGGGAAGAAAGAGGAAGGGGG + Intronic
1127559060 15:60117935-60117957 CAGGGAAAAAAGGTTGAAGGAGG + Intergenic
1127568274 15:60214907-60214929 CAGAGGAAAAAGGAGAGAGAAGG + Intergenic
1127653613 15:61034240-61034262 AAGGGGGAAAAAGAGGAAGCAGG + Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127953792 15:63834763-63834785 CAGGTACAGAAGGAGGAAGATGG - Intergenic
1128095809 15:64954493-64954515 GAGGAGAAGAAGGAAGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128485709 15:68085374-68085396 GTGGGGAAAAAGGAGAAAGGGGG + Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128678844 15:69631701-69631723 GAGGAGACAAAGGAGGAAAAAGG + Intergenic
1128698172 15:69784450-69784472 AGGGGGAAAGAGTAGGAAGAGGG - Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1128789702 15:70423913-70423935 GAGGGGCAAAAGGAAGATGAGGG - Intergenic
1128846825 15:70906045-70906067 TAGGGGAGAAAGGTGGGAGAAGG + Intronic
1129121186 15:73397704-73397726 CAGGGGAAAAATAGGGAACAAGG + Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129316714 15:74749704-74749726 CAGGGAAAAAAGGAGGGACCAGG - Intronic
1129337137 15:74859398-74859420 CAGAGCAAAAAACAGGAAGAAGG + Intronic
1129450500 15:75648550-75648572 CAGGAGCAAGAGGAGGAAGGAGG + Exonic
1129695677 15:77739496-77739518 CAAGGGAAAAAGGAGGGGAAAGG - Intronic
1129727630 15:77909614-77909636 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1129840257 15:78739356-78739378 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1129983997 15:79900322-79900344 GAAGGGAAAGAGGAAGAAGAGGG - Intronic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130275938 15:82476398-82476420 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130468299 15:84203790-84203812 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130485450 15:84395964-84395986 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1130490299 15:84426028-84426050 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130495967 15:84469752-84469774 GAAGGGAAAGGGGAGGAAGATGG + Intergenic
1130590592 15:85208388-85208410 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1130608365 15:85337948-85337970 CAATGGAAAAAGGAGGGAGCGGG - Intergenic
1130747904 15:86675770-86675792 GAGGGGGAAAAAGAGAAAGAAGG - Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1130959315 15:88649257-88649279 CCGAGGAAAGAAGAGGAAGAAGG - Intronic
1130989979 15:88870358-88870380 CAGGGGAAGAAGGAAGAAGGGGG + Intronic
1130993203 15:88889047-88889069 GAGAGGGAAGAGGAGGAAGACGG + Intronic
1131297937 15:91168490-91168512 CAGAGGAAAAAGGGAGAAAAAGG + Intronic
1131302011 15:91207911-91207933 CAGGGGAGAAGTGAGGAAGAAGG + Intronic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131631041 15:94176981-94177003 AAGGGGAGAAAGGGTGAAGAAGG - Intergenic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132222727 15:100117009-100117031 CAGGGCTAGAAGGAAGAAGAAGG + Exonic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1202986296 15_KI270727v1_random:420047-420069 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1133035712 16:3032999-3033021 CAGGGGTCAAAGGTGGAAGCTGG + Intronic
1133037252 16:3040595-3040617 CAGGAGAAAAATGAGTAGGAGGG + Intergenic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133139457 16:3733462-3733484 CAGGGGAAAACTGAGGAAATTGG + Intronic
1133225444 16:4338384-4338406 CGGGGGTAGAAGGAGGAAGACGG - Exonic
1133379967 16:5321699-5321721 CAGGTGTGGAAGGAGGAAGATGG - Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133520164 16:6549212-6549234 GAGGGGAGGAGGGAGGAAGAGGG + Intronic
1133605579 16:7384580-7384602 ATGGGGAAATAGGAGGGAGAGGG + Intronic
1133740171 16:8645264-8645286 TAAGGAAAAAGGGAGGAAGAGGG + Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134108202 16:11499065-11499087 GAGGGGGGAAGGGAGGAAGAGGG + Intronic
1134297717 16:12961624-12961646 AGGGGGAAGAAGGAGAAAGAAGG + Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134656848 16:15953977-15953999 GAGGGGAAAACAGAGGAAGTAGG - Intronic
1135112100 16:19698337-19698359 AACAGGAAAGAGGAGGAAGAAGG - Intronic
1135166826 16:20146492-20146514 AAGGGGAGGAAGGAGGGAGAAGG + Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135563445 16:23494114-23494136 GACGAGAAACAGGAGGAAGAAGG + Intronic
1135885681 16:26304894-26304916 AAGAGGAAAAACCAGGAAGAGGG - Intergenic
1136045913 16:27614819-27614841 CAGGGGAAGATGGAAGCAGATGG + Intronic
1136382169 16:29900757-29900779 CAGGGGAGCTAGGAGGAAGCGGG + Exonic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1137789486 16:51162980-51163002 CAGAAGAAAAGGGAGGGAGAAGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138150183 16:54649685-54649707 CAGAGGAAAAAGGGGGCAGATGG + Intergenic
1138192640 16:55028162-55028184 CAGGGGAAAACGGTGGGAGATGG + Intergenic
1138224730 16:55282850-55282872 AATGGGAGAGAGGAGGAAGAAGG + Intergenic
1138298722 16:55908920-55908942 ATGGAGAGAAAGGAGGAAGAAGG - Intronic
1138448648 16:57079844-57079866 ATGGGGAAAAAGGCAGAAGAAGG - Intronic
1138606671 16:58094271-58094293 CAGGGGTGAGAGGAGGGAGAGGG - Intergenic
1138860110 16:60745297-60745319 CAAGAGAAAAATGAGGAAGAAGG + Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1139203860 16:65006374-65006396 CAGGGAAGAAGGGAGCAAGAAGG + Intronic
1139521397 16:67484506-67484528 CAGTGGAAAAAAGATGAAGGGGG + Intergenic
1139629180 16:68217768-68217790 ATGGGAAAAAGGGAGGAAGAAGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140065597 16:71608777-71608799 AAGGGAAAAAAGGCAGAAGAGGG - Intergenic
1140109951 16:71995419-71995441 TAGGGCAGAAAGGATGAAGATGG - Intronic
1140195090 16:72848800-72848822 AAGGGAAAGAGGGAGGAAGAAGG - Intronic
1140276385 16:73512569-73512591 CAGTTGGAAAAGGAGGCAGATGG + Intergenic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140400320 16:74666062-74666084 GAGGGGGAAGAGGAGGGAGAGGG + Intronic
1140407949 16:74723513-74723535 GGCGGGAAGAAGGAGGAAGACGG - Intronic
1140426553 16:74866184-74866206 CCGGGGAAATCTGAGGAAGATGG - Intergenic
1140471385 16:75217198-75217220 CAGGGGAAAAAGAAAAAAAAAGG + Intergenic
1140499465 16:75421239-75421261 AAGGGAAAAAAGGGGGAACAGGG - Intronic
1140650910 16:77087394-77087416 CTGGGGAAAATGGAGAAAAATGG + Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140856756 16:78984838-78984860 AAGGAGAAAGACGAGGAAGAAGG + Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1140961213 16:79914911-79914933 CAGGGGAAGAAGGAGAAATGAGG + Intergenic
1141319718 16:82996016-82996038 CAAGGGAGAAAACAGGAAGATGG - Intronic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141514560 16:84535092-84535114 TTGGGGGAGAAGGAGGAAGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141934018 16:87224743-87224765 GAGGGGGAGAAAGAGGAAGAGGG - Intronic
1141946104 16:87311071-87311093 AAGGGGAGATGGGAGGAAGAAGG - Intronic
1142404910 16:89882970-89882992 TTGAGGAGAAAGGAGGAAGAAGG + Intronic
1142761123 17:2042420-2042442 CAGGAGACAGCGGAGGAAGACGG - Intronic
1142887291 17:2920635-2920657 CAGGGATTAAAGGAGGAAGCAGG + Intronic
1142889898 17:2936469-2936491 GAGAGGAAGAGGGAGGAAGAAGG - Intronic
1143287319 17:5800037-5800059 GGGGGAAAAAAAGAGGAAGAAGG - Intronic
1143391328 17:6560950-6560972 GAGGAGGAAGAGGAGGAAGAGGG - Intergenic
1143624944 17:8104296-8104318 CAGGGGGAAAGTGAGGAAGTAGG + Intronic
1143794687 17:9327206-9327228 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144214468 17:13043160-13043182 CAAGAGAAAGAGGAGGGAGAGGG + Intergenic
1144222495 17:13112730-13112752 CAGGGGAGAAGGGCAGAAGAAGG + Intergenic
1144305213 17:13963750-13963772 CAAGGGAAAGGGGAGGATGAAGG - Intergenic
1144457562 17:15431559-15431581 CATGGGAACAAGGAGCAAGCTGG + Intergenic
1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG + Intronic
1144613772 17:16749845-16749867 CAGCCAAAAAAGGATGAAGAAGG - Intronic
1144656618 17:17041460-17041482 TAGGGGAAGAAGGAGCAAGAGGG - Intergenic
1144748781 17:17633920-17633942 GAAGGGAAGATGGAGGAAGAGGG - Intergenic
1144898941 17:18565821-18565843 CAGCCAAAAAAGGATGAAGAAGG + Intergenic
1144902366 17:18608522-18608544 CTGGGGAAAGATGAGGATGAGGG - Intergenic
1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145133436 17:20379898-20379920 CAGCCAAAAAAGGATGAAGAAGG - Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1145829897 17:27907459-27907481 CAGAGGAAAGAGGGAGAAGATGG + Intergenic
1146427792 17:32759908-32759930 GAGGAGAAAAAGGAGGAAAAAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146488412 17:33262337-33262359 GGGGGAGAAAAGGAGGAAGAGGG + Intronic
1146620285 17:34391796-34391818 CAGGGGCAAGATGAGGAAGAGGG + Intergenic
1146661137 17:34665859-34665881 CATAGAAAAACGGAGGAAGATGG + Intergenic
1146697228 17:34918965-34918987 CAAGAGAAAAACGAGGAAGAAGG - Intergenic
1146697525 17:34920899-34920921 CAAGAGAAAAATGAGGAAGAAGG - Intergenic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1146915051 17:36673072-36673094 CAGGTGATATAGGAGGAAGGTGG + Intergenic
1146936110 17:36813574-36813596 CAGAGGAAGAAGGAGGAATGAGG + Intergenic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147169834 17:38611508-38611530 CAGAAGAAAAGGGAAGAAGAGGG + Intergenic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147397772 17:40158135-40158157 GCAGGGAAAAATGAGGAAGAGGG + Intronic
1147431587 17:40374687-40374709 GAGGACAAAAAGGAGGAGGAGGG - Intergenic
1147439838 17:40441286-40441308 TGGGGGAAGAAGCAGGAAGAGGG + Intergenic
1147625258 17:41896044-41896066 GAGGTGAAGAAGGAGGTAGACGG - Intronic
1147917536 17:43897716-43897738 GAGTGGAAGAATGAGGAAGAGGG - Intronic
1147959248 17:44156157-44156179 AAGGGGAAAGATGAGGAAAATGG - Intronic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148026095 17:44588678-44588700 AAGAAGAAAAAGGAGTAAGACGG - Intergenic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148745138 17:49913903-49913925 GAGGAGGAAGAGGAGGAAGATGG + Intergenic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149077466 17:52613433-52613455 GATGAGGAAAAGGAGGAAGAAGG - Intergenic
1149107080 17:52982588-52982610 GAGGGGGAGAAGGAGGAAGGGGG - Intergenic
1149337179 17:55647936-55647958 CAGAAGAAAAGAGAGGAAGATGG + Intergenic
1149399910 17:56285452-56285474 AAGTGGAATAAGGAGGAAAAAGG - Intronic
1149412627 17:56424484-56424506 AAGGAGAAAAATGTGGAAGAAGG + Intronic
1149500577 17:57149313-57149335 GAGGGGAAAAATGAGGGGGAAGG + Intergenic
1149524292 17:57341906-57341928 AAAGAGAACAAGGAGGAAGAAGG - Intronic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1149626199 17:58082817-58082839 CAAAGAACAAAGGAGGAAGAAGG + Intergenic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150150901 17:62808235-62808257 TCGGGGAAGGAGGAGGAAGAGGG - Exonic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150580912 17:66473101-66473123 CAGGAGAAGAAGGAGGAATGGGG - Intronic
1151050961 17:70978419-70978441 GATGGGAGAAAGGAAGAAGACGG + Intergenic
1151127900 17:71865091-71865113 CAGGGCAACAAAGAGGAAGGGGG + Intergenic
1151396829 17:73828247-73828269 CAGGAGAGAAAGGATGAAGGAGG - Intergenic
1151757683 17:76083912-76083934 CAAGGGAAAAAGGAGAAGGGTGG - Intronic
1151859055 17:76745689-76745711 CAGGAGAAGAGGGAGGGAGATGG - Intronic
1151935168 17:77256879-77256901 GAGGGGAGCAAGGAGGTAGAAGG + Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152305491 17:79518071-79518093 CCTGGGGAAAAGGAGGAGGAGGG - Intergenic
1152322357 17:79614821-79614843 GAGGAGAAAAAGAAGAAAGAGGG + Intergenic
1152557335 17:81059968-81059990 CATGGGCACAAGGAGGAGGAGGG + Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153072548 18:1122422-1122444 CAGTAGAAAAAGGACAAAGAAGG - Intergenic
1153092705 18:1366586-1366608 GAGGGAGAGAAGGAGGAAGAGGG - Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153368704 18:4288651-4288673 GGGGGAAAAAAGGAGAAAGAGGG + Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153449672 18:5213248-5213270 CAAGCGAAAAAGGAGTAAAAAGG + Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1153764750 18:8364991-8365013 TAATGGAAAAAGGAGGATGATGG + Intronic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154031408 18:10756889-10756911 CAGGATAAAAAGGAGGAATGGGG + Intronic
1154082507 18:11272419-11272441 CAGGGGAAGATGGAAGAAAATGG + Intergenic
1154986384 18:21555249-21555271 CAGGGGTTAAGGTAGGAAGAAGG + Intronic
1155106688 18:22673948-22673970 AAGATGAAAAATGAGGAAGATGG + Intergenic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155883286 18:31177234-31177256 GAGAGGAAAAAGGAGGAAAAGGG + Intergenic
1156019424 18:32582915-32582937 GAGGGGGAAAAAGAGGAGGAGGG - Intergenic
1156140283 18:34100353-34100375 CAGGGGAAAGAGGTAGGAGATGG - Intronic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156289361 18:35732439-35732461 CAGGGGTAAAGGGAGGGAGTGGG + Intergenic
1156329378 18:36105115-36105137 CAGGCAAAAAAGGAGAAATATGG + Intergenic
1156505122 18:37585707-37585729 TAGTGGAAAAAGTAGGAAAAAGG + Intergenic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156689670 18:39692395-39692417 AAGGGAAAGAAGGAGGAAAAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157072513 18:44424491-44424513 AACAGGATAAAGGAGGAAGATGG + Intergenic
1157382017 18:47227145-47227167 AGGAGGAAGAAGGAGGAAGATGG - Intronic
1157415678 18:47500774-47500796 CAGGGAAACAAGGATGAAGGGGG + Intergenic
1157464825 18:47934034-47934056 CTGGGGAAAAGGGAGCAAGGTGG - Intergenic
1157465184 18:47937909-47937931 CTGGGGAAAAGGGAGCAAGATGG - Intergenic
1157467375 18:47958887-47958909 CAGAGATAAAAGGAGGCAGAGGG - Intergenic
1157494089 18:48142864-48142886 GAGGAGCAAAAGGAGGAGGAAGG - Intronic
1157496028 18:48158177-48158199 AAAGAGAAAAAGGAGGAACAGGG - Intronic
1157543875 18:48534181-48534203 GGGGGGAAAGAGGAGGGAGAGGG - Intergenic
1157615569 18:48985558-48985580 CAGGAGAAAAAGGTGCAAGGAGG - Intergenic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157735484 18:50044896-50044918 GGGGGGAAAAAGGAGGGAGAGGG + Intronic
1158005982 18:52672631-52672653 AAGGGGAAAAAGAGGAAAGAGGG - Intronic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1158088297 18:53680540-53680562 AAGGAGGAAAAGGAGGAAAAGGG + Intergenic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158227141 18:55213218-55213240 CAGGGGTGAAAAGAGGCAGAAGG - Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158358618 18:56647937-56647959 GAGAGGAAAAGGGAGGAAGCAGG + Intronic
1158523022 18:58187412-58187434 CCGGGGAAGAAGGAGTAAGAAGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158693969 18:59686702-59686724 CAGCTGAAAAAGGAGGAAGTGGG - Intronic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1158883574 18:61804650-61804672 CAAGAGAAAAAGGAGGCATAGGG - Intergenic
1159183353 18:64939516-64939538 CAGGGGGAAAAAGAGGTAAATGG - Intergenic
1159424552 18:68268431-68268453 CAGGGGAAAAAAGAAAATGAAGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1159872824 18:73777665-73777687 AAGGGGAAAGAGGAAGAAAATGG + Intergenic
1159933089 18:74334324-74334346 AAGGGGAGAAAAGAGGAGGAGGG + Intronic
1160312050 18:77803243-77803265 CAGGGGAAAGATGAGGAACGTGG - Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161370534 19:3908640-3908662 AAGGGGAAGGGGGAGGAAGAAGG - Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161544821 19:4874060-4874082 CAGGGGAAAAAAGATGAAGCTGG + Intergenic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162044690 19:7990801-7990823 TAGAGGGAAGAGGAGGAAGAGGG + Intronic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162105375 19:8366837-8366859 CAAGAGAGGAAGGAGGAAGAGGG - Intronic
1162716327 19:12636684-12636706 GAGGGGAAAAAGGGGGATGAAGG - Intronic
1162717143 19:12641347-12641369 CAGGGGGAAGGGGAGGTAGAGGG - Intergenic
1162844725 19:13383366-13383388 ATGGGGAAGATGGAGGAAGAAGG + Intronic
1162985830 19:14268983-14269005 CAGGGGAAAAAGTAGGGTGGGGG - Intergenic
1163061288 19:14763975-14763997 AGGAAGAAAAAGGAGGAAGAGGG - Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163200933 19:15768583-15768605 AAAGGGAGAAAGAAGGAAGAGGG - Intergenic
1163326334 19:16605718-16605740 TAGGGGAACAAGGAGGCAGGCGG + Intronic
1163382489 19:16978205-16978227 CATGGGCAACAGGAGGAAGTGGG + Intronic
1163465805 19:17467991-17468013 GAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163611552 19:18304451-18304473 GAGGGGAATGGGGAGGAAGATGG + Intergenic
1163658394 19:18561711-18561733 CAGGGGATGAGGGAGGAAGCTGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164335596 19:24316314-24316336 CAGGAAAAAAAGGAGAAGGAAGG + Intergenic
1164347329 19:27282546-27282568 CAGGGGAATTAGGCAGAAGAAGG - Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164441897 19:28285128-28285150 GAGGGGAAGAAGGAGAAGGAGGG + Intergenic
1164587067 19:29482614-29482636 CAGGGGGAAAAGAAGGGAGTTGG - Intergenic
1164609829 19:29624377-29624399 CAGGGGAAAAGGGAGCAGGCAGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1164858223 19:31541920-31541942 CATGGAAAAGAGGAGGCAGAAGG + Intergenic
1164864639 19:31594242-31594264 CAGAGGAAGAAGGAGGCACAGGG - Intergenic
1164957809 19:32402187-32402209 CAGGAGGAAGAGGAAGAAGAAGG + Intergenic
1165137660 19:33680061-33680083 AAAGGGAAAAGGGAGGAAGCTGG - Intronic
1165298549 19:34949920-34949942 GAGAGAAACAAGGAGGAAGAGGG + Intergenic
1165364675 19:35358199-35358221 CAGGGGAGAAAGCAGAAACATGG + Intergenic
1165468769 19:35990826-35990848 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468771 19:35990836-35990858 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468773 19:35990846-35990868 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468775 19:35990856-35990878 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165601562 19:37058926-37058948 CAAGGGAGAAGGGAGGCAGAGGG + Intronic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1166346586 19:42170069-42170091 TGGGGGGAAAAGGAGGAGGAGGG + Intronic
1166542855 19:43617095-43617117 CAGGCCAAAAAGGGGGAAGGAGG - Intronic
1166557024 19:43707039-43707061 CAGGGGAAAAAGGATGTCTAGGG - Intergenic
1166672435 19:44718976-44718998 CAGGGCAAAAAGGGAGAAGAAGG + Intergenic
1166860279 19:45806285-45806307 GAGGAGGAAAAAGAGGAAGAAGG + Intronic
1166960294 19:46492923-46492945 GAAGGGAAAGAGGAGGAGGAGGG - Exonic
1167051981 19:47084992-47085014 AAAGGGAAAAAGGACTAAGAAGG + Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167367401 19:49061947-49061969 GAGGAGGAAAAGGAGGAGGATGG + Exonic
1167556422 19:50199026-50199048 CTAGAGCAAAAGGAGGAAGAGGG - Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167622889 19:50568711-50568733 CAGGGGAGAGAGGAGGGAAAGGG + Intergenic
1167665446 19:50820780-50820802 CCAGGGAAGAGGGAGGAAGAGGG + Intronic
1167728711 19:51236825-51236847 CAGCAGAATAAGGAGTAAGAGGG - Intronic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1167804551 19:51771688-51771710 TAGGGGAAACAGGAGGGAAAGGG - Intronic
1167967161 19:53157493-53157515 CAGGTGCAAGCGGAGGAAGAAGG - Intronic
1168025557 19:53641094-53641116 CAGAGGAAACAGGAGGGAAAAGG + Intergenic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168189347 19:54726557-54726579 CAGGGGACTGAAGAGGAAGATGG + Intronic
1168517460 19:57019404-57019426 CAGGGGATGAATGAGGAAAATGG + Intergenic
1168695403 19:58401245-58401267 CCGGGGCAAGAGGAGGGAGAAGG - Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925740826 2:7004645-7004667 CTGGGGAAAAAGGCAGAAAAAGG - Intronic
925755550 2:7128377-7128399 GAGGGGGGAAAGGAGGAAGGGGG - Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926731381 2:16038286-16038308 CAGGGGAGGAGGGAGGGAGATGG + Intergenic
926752840 2:16212041-16212063 CAGGGGAGAAAGGCTGGAGAAGG + Intergenic
926814547 2:16787260-16787282 GAGAGGAAAAGGGAGGAACAGGG + Intergenic
926968688 2:18444443-18444465 TAGAGGAAAAAGGAGAAAGGGGG + Intergenic
927135775 2:20095340-20095362 TAGGGGTGAAATGAGGAAGAAGG - Intergenic
927140891 2:20130101-20130123 CAAGTGAGACAGGAGGAAGAGGG - Intergenic
927300283 2:21504375-21504397 TAGAGGAAAAATGAGGCAGAAGG - Intergenic
927386612 2:22541503-22541525 CAGGTGAGAAGGGAGGAATATGG - Intergenic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928249307 2:29660670-29660692 GAGGGGAGAAAGGGGGAAAAAGG + Intronic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928798782 2:35060240-35060262 CAGGTGAAAAAGTGGGAAGGGGG + Intergenic
928914601 2:36457570-36457592 CAGGGGAGAAAGGGTGAAGGAGG + Intronic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929162045 2:38841689-38841711 CTACGGAAAAAGGAGCAAGAAGG + Intronic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
929444474 2:41991889-41991911 CAAGGGGGAAAGGAGGGAGAAGG + Intergenic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
929789928 2:45014648-45014670 GGGAGGAAAGAGGAGGAAGAGGG - Intergenic
929993681 2:46811754-46811776 AAGGAGAAAAAGGAGGAAAAAGG - Intergenic
930139595 2:47938506-47938528 CTTGGGAAAGAGGAGGAGGAGGG - Intergenic
930227223 2:48806109-48806131 CAAGAGAAAAAGGAGGAATAAGG + Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930658133 2:54027326-54027348 CTGGGGGAAAAGGAGGGAAAAGG - Intronic
931000173 2:57770874-57770896 AAAGGGAAGAAGGAGAAAGAAGG - Intergenic
931063111 2:58553586-58553608 AAGGGGGAAAAGGAAGGAGAAGG - Intergenic
931081937 2:58783582-58783604 CTGGGGTAAAAGGAGGTAAAAGG - Intergenic
931330081 2:61271692-61271714 GAGGGGAAGAAGGGGGAAGGAGG + Intronic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931464378 2:62473854-62473876 CAGAAGAGAAAGGAGGAAGTAGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932783319 2:74577753-74577775 CAGAGGAAATAAGAGGAAGCTGG - Intronic
932815166 2:74855582-74855604 CAGGGGAAAAAGGATCACGGTGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932831049 2:74990612-74990634 AAGGGGCAGAAGGAGGGAGAGGG - Intergenic
932841529 2:75087721-75087743 CAGGGGAAAAGTGATTAAGAAGG - Intronic
932848095 2:75155415-75155437 GAGGAGAGAAAGGGGGAAGAAGG - Intronic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
932923455 2:75943116-75943138 CAGGGGAAAATGGAGGGAAAGGG - Intergenic
933003984 2:76966314-76966336 CAGGGAGCAAAGGAGGAAGTGGG + Intronic
933117279 2:78489987-78490009 AATGGGAAAAAGGAAAAAGAAGG + Intergenic
933441094 2:82315370-82315392 GAGGGGAAAAGGGAGAGAGAGGG - Intergenic
933800248 2:85954694-85954716 CAAGGCAAAATGGAGGAACAGGG + Intergenic
933888129 2:86739412-86739434 CAGGAAAAAAAGGAGGAGAAGGG - Intronic
933922049 2:87057294-87057316 CAGGAAAAAAAGGAGGAGAAGGG + Intergenic
934029113 2:88025557-88025579 CAGAACAAAAGGGAGGAAGAAGG - Intergenic
935177246 2:100660380-100660402 CAGGAAAAAAAAGAGGAAAACGG + Intergenic
935433017 2:102998284-102998306 CAGGGACAAAAGGAGGAATGAGG + Intergenic
935566357 2:104612205-104612227 CACGGGAAAAGGCAGGAAGAGGG - Intergenic
935753673 2:106260876-106260898 AAGGGGAGAAGGGAGGATGAGGG + Intergenic
935874821 2:107494866-107494888 CAGAGGAAAAAGGGGAAGGATGG + Intergenic
935943691 2:108267764-108267786 TAGGGGTAAAATGAGGAAAAGGG - Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937141646 2:119606913-119606935 CAGGGGAAAAAGGTGCATGCAGG - Intronic
937227164 2:120376503-120376525 CAGAGGAGAAGGGAGGAAGGAGG - Intergenic
937453908 2:122025122-122025144 AAGGAGAAGAAGGTGGAAGATGG + Intergenic
937490247 2:122359518-122359540 GAGGAGGAAAAGGAGGAGGAAGG - Intergenic
937534363 2:122867441-122867463 CAGAAGAAAAAGGAAGAAGATGG + Intergenic
937543924 2:122990817-122990839 AAGGAAAAAAAGGAGAAAGAGGG + Intergenic
937562138 2:123239258-123239280 CAGAGGAAAAGACAGGAAGATGG + Intergenic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938195436 2:129323419-129323441 TAGAACAAAAAGGAGGAAGAAGG - Intergenic
938253072 2:129831270-129831292 CAGTTTAAAAAGGAGGAAAATGG - Intergenic
938542507 2:132296165-132296187 GAAGGGAAGAAGGAGGAAGAGGG - Intergenic
938609283 2:132930466-132930488 AAAGGTAAAAAGGTGGAAGAAGG + Intronic
938713813 2:134000457-134000479 CAGGGGAAAAGGAAGTCAGATGG + Intergenic
939316413 2:140556186-140556208 CAGGGGAGAAAGGAGAGAGAAGG - Intronic
939366939 2:141245908-141245930 TTGTGGAAAAAAGAGGAAGAAGG - Intronic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939579193 2:143928270-143928292 GAGGGGAGAAAGGAGAGAGAAGG + Intergenic
939629017 2:144512834-144512856 CAGAGAAAAAAGGATGGAGATGG + Intronic
940185069 2:150975403-150975425 CAAGGGAAAAGGGTGGGAGAAGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
940372309 2:152917045-152917067 CATGGCAAAAAGGAGGAACACGG - Intergenic
940485862 2:154294914-154294936 CAGGGTAGAAAGGTGGGAGAAGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941105819 2:161351585-161351607 CAGGGGAAAGAGGAGGGTAAGGG - Intronic
941194315 2:162428332-162428354 GAAGGGGAGAAGGAGGAAGAGGG - Intronic
941297954 2:163764007-163764029 CAGGAGAGAAAGGAAGAAAAAGG - Intergenic
941505276 2:166336434-166336456 CATGGGAACATGGAGGAAGAAGG + Intronic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
941728599 2:168890541-168890563 GAGGGGAAAATGGGGGAACAGGG + Intronic
941770378 2:169338419-169338441 AAAAGAAAAAAGGAGGAAGACGG + Intronic
941958105 2:171225447-171225469 AAGGGGAAAAAAAAGGAAAAAGG + Intronic
941989533 2:171541440-171541462 CAGGGGTAACATGGGGAAGAGGG + Intronic
942083181 2:172420761-172420783 CTGGTGAAAAAGGAGAAAAATGG - Intergenic
942222715 2:173787219-173787241 CAAGGGAGAAAGGTGGGAGAAGG - Intergenic
942322772 2:174750422-174750444 CATGGGACACAGGAAGAAGATGG + Intronic
942347843 2:175021348-175021370 CAGGGGCAAAGGGAGCAAGTGGG + Intergenic
942534414 2:176948420-176948442 CATGGGAAAAAGGCAGGAGAAGG - Intergenic
942543943 2:177043504-177043526 AGGGGAAAAAAGGAGGAAAAAGG - Intergenic
942692578 2:178601967-178601989 CAGTGGAAAAAAGAGGAGAATGG + Intronic
943726528 2:191257034-191257056 AAGGGGAAGGGGGAGGAAGAGGG - Intronic
943775200 2:191757980-191758002 CAGGTGAAAATGGAGGGGGAGGG + Intergenic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
943920047 2:193694723-193694745 GAGGGAAAAAGGGAGGAAAAGGG + Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944402559 2:199345061-199345083 CAGGTGGAGAAGGAAGAAGAGGG - Intronic
944475998 2:200107442-200107464 CAGGAAAAAAAAGAAGAAGAAGG + Intergenic
944501137 2:200361286-200361308 GAGAAGAAAAAGGAGAAAGAAGG + Intronic
944523111 2:200591311-200591333 CATGGGAACAAAGAGGAGGATGG + Intronic
944951611 2:204756900-204756922 GAGGGAAGAAAGGAGGAAAAGGG - Intronic
944966773 2:204944194-204944216 CATGGGGAAAAGGAGAAAGCAGG + Intronic
945185760 2:207137843-207137865 CTGGGGAAAGATGAGGGAGAGGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945838579 2:214861389-214861411 TAGGGGAAAAGGGAGGAAAGGGG - Intergenic
945924975 2:215794129-215794151 AAGGAGGAAAAGGAGGGAGAGGG + Intergenic
946084316 2:217155939-217155961 GAGAGGAAAAGGGAAGAAGAGGG - Intergenic
946149457 2:217754233-217754255 AAGGGGAAAAGGGAGGGAAAGGG + Intronic
946152421 2:217785504-217785526 CCGGGGACACAGGAGGCAGAGGG - Intergenic
946212898 2:218161902-218161924 AAGGTGAAGAAGGAGGAAGTTGG + Intergenic
946359107 2:219208365-219208387 AAGGGGAAAAAGGGGGAGCAGGG - Intronic
946363603 2:219234932-219234954 GAGGAGAAAAAGGAATAAGAAGG + Exonic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946463370 2:219889918-219889940 CTGGGGCAAGATGAGGAAGAGGG - Intergenic
946469225 2:219940835-219940857 CAGTGCAAAATGGATGAAGATGG + Intergenic
946728792 2:222688798-222688820 GAGGGCAAAAAAGAGCAAGAGGG + Intronic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946969663 2:225077925-225077947 CAGCTGCAAAAGGAGCAAGATGG - Intergenic
947049946 2:226031072-226031094 GAGGGGAGGAGGGAGGAAGAGGG - Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947390601 2:229635412-229635434 CAAGGGTACAAAGAGGAAGAGGG + Intronic
947509469 2:230737961-230737983 CGGGTGAAAAAGCAGGCAGAAGG - Intronic
947511018 2:230754415-230754437 AAGGGGAAGAAGGAGGGAAAGGG - Intronic
947511031 2:230754451-230754473 GAGGGGAAGAAGGAGGGAAAGGG - Intronic
947972687 2:234337290-234337312 CGAGGGACAAAGGAGGAAGGAGG + Intergenic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948228106 2:236328654-236328676 CAAGGCTAAAAGAAGGAAGAGGG - Intronic
948286238 2:236787602-236787624 AAGAGAAAAAATGAGGAAGATGG - Intergenic
948460253 2:238125611-238125633 CAGGGGTAAAAGCGGGGAGACGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948603471 2:239120573-239120595 CAAGGGGAGAAGGAGGAAGGTGG + Intronic
948691881 2:239711415-239711437 CCAGGGACAAAGGAGGAGGAGGG - Intergenic
948751815 2:240137464-240137486 AAGGGGTAAGAGGAGGGAGAAGG + Intergenic
948814015 2:240500489-240500511 CAGGGAGAAAAGGAGGCAGTGGG - Exonic
948955732 2:241289268-241289290 CATGAGACAAAGGAGGAAGCAGG - Intronic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1169015421 20:2289026-2289048 CATGGGTAAAAGGAGGAAGTTGG + Intergenic
1169027537 20:2383329-2383351 CAAGGGCAGGAGGAGGAAGATGG + Intronic
1169558276 20:6770803-6770825 CAGAGGGAAAAGGAGAAAAAGGG + Intronic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1169709755 20:8548238-8548260 AAGGGTGAAAAAGAGGAAGAGGG - Intronic
1169895007 20:10494710-10494732 AGGGGGAGATAGGAGGAAGAAGG - Intronic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170489852 20:16861938-16861960 CAGTGGACAGAGGAGGAAAATGG + Intergenic
1170519168 20:17165971-17165993 CAGGGGGAAAAGGAGGGAACTGG + Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1170717874 20:18847628-18847650 GAAAGGAAAAAGGAGGAAGCAGG + Intergenic
1170731103 20:18975442-18975464 AAGGGAGAAAAAGAGGAAGAGGG - Intergenic
1170948919 20:20916630-20916652 GAAAGGAAAAAGGAGGAGGATGG + Intergenic
1170995685 20:21355219-21355241 CTGGGGAGAAAGGAGGAGTAGGG - Intronic
1171163611 20:22951391-22951413 CAAGGCAAAGAGGAAGAAGATGG + Intergenic
1171570759 20:26249199-26249221 AAGATGAAAAAGGAGTAAGAGGG - Intergenic
1171871387 20:30529012-30529034 GAAGGGAAGAGGGAGGAAGAGGG - Intergenic
1172062787 20:32197703-32197725 TAGGGGAGAAAGCAGAAAGAGGG + Intronic
1172519622 20:35558361-35558383 CAGGGGAAAAGCGAGAGAGAGGG + Intergenic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1172957649 20:38772526-38772548 AAGGGGAAAAAATAGGAGGAGGG - Intergenic
1172979187 20:38928040-38928062 CTGGGGATCAAGGAGGAAGAAGG + Intronic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173486974 20:43448292-43448314 GAGGGGAGAAAGCAGGGAGAGGG + Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173906722 20:46634913-46634935 CAGGGGAAAAGGGACATAGAGGG - Intronic
1174055723 20:47796936-47796958 AAAGGGAAAAAGGAGGTAGGTGG - Intergenic
1174108661 20:48182183-48182205 AAAGGGTAAAAGGAGGAAAAAGG + Intergenic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174224810 20:48989111-48989133 GATGGGAAAAATGAGGCAGAGGG - Intronic
1174254898 20:49247259-49247281 CAGGGGATGATGTAGGAAGATGG - Exonic
1174259635 20:49284528-49284550 CAGGGGAAATAGTAAGAAAAAGG - Intergenic
1174282958 20:49452608-49452630 GAAGGGAAAAGGCAGGAAGATGG + Intronic
1174559417 20:51419422-51419444 GATGGGAAAAAAGAGGAAGGAGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174639346 20:52029792-52029814 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1175135218 20:56818375-56818397 GAAGGGAGGAAGGAGGAAGAGGG + Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175323379 20:58105473-58105495 CAGGCGTAAAAGGAGCAAGGCGG - Intergenic
1175406241 20:58731635-58731657 CAGGCGCAAAAAGAGGAAAAAGG + Intergenic
1175503321 20:59465496-59465518 ATGGGGCAGAAGGAGGAAGAAGG - Intergenic
1175531209 20:59675048-59675070 GAGGGGGAAAAGGAGGAACAGGG - Intronic
1175574393 20:60049929-60049951 TAGGGGAGAGAGGAGCAAGAGGG - Intergenic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1176047249 20:63099350-63099372 CAGGAGGGAAGGGAGGAAGAAGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176264778 20:64203508-64203530 GAGGGGAAGAGGGAGGAAGAGGG - Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176330389 21:5544618-5544640 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176397368 21:6276333-6276355 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176439789 21:6712771-6712793 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176464051 21:7039840-7039862 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176487612 21:7421619-7421641 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177259193 21:18706945-18706967 AAAGGGGAAAAGGGGGAAGAGGG - Intergenic
1177543052 21:22520562-22520584 GAGAGGACAAAGGAGGAGGAAGG - Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1177874582 21:26615586-26615608 GAAGGGAGGAAGGAGGAAGAAGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178188813 21:30256525-30256547 TAGGAGAAAGAGGCGGAAGAAGG - Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178330753 21:31689089-31689111 CAGTGGTAAAAAGAAGAAGATGG - Intronic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178643207 21:34363381-34363403 AAGAGGAAGAAGGAAGAAGAAGG - Intergenic
1179272555 21:39862655-39862677 CAGGAGAGAAAGGAAGAATATGG - Intergenic
1179291217 21:40019926-40019948 AAGGGAAAGAAGGAGGGAGAAGG - Intronic
1179499135 21:41796047-41796069 GAGGGGAGAAAGGGGGAAGGGGG - Intergenic
1179956738 21:44744999-44745021 CAAGGGAAATAGGACGAACATGG + Intergenic
1180104268 21:45607619-45607641 GAGGGGAAAATGGAGGAGAAAGG + Intergenic
1180105837 21:45617502-45617524 CAGGGGAACAGGGAGAAAGGAGG - Intergenic
1180568178 22:16692867-16692889 CAGGGGACAAAGGTGGAAGCTGG + Intergenic
1180572919 22:16746215-16746237 AAGATGAAAAAGGAGTAAGAGGG - Intergenic
1180883867 22:19225781-19225803 CACGGGAAAAAGTAGGAGCAAGG + Intronic
1181170112 22:21003362-21003384 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1181452595 22:23033914-23033936 CAGGGGAGCAAGGATGAAAATGG + Intergenic
1181814931 22:25430469-25430491 CAGGGGACAAGGGAGGGAGGGGG + Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182196478 22:28523957-28523979 AAAGGGAGAAAGGAGGAAAAGGG - Intronic
1182732863 22:32509390-32509412 AAGGGCAAAAAGGAGGGAGAGGG - Intergenic
1182888063 22:33792878-33792900 CACGGGAAAAAGAAAGGAGAAGG + Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1182961434 22:34479075-34479097 GAGTGGAGGAAGGAGGAAGAGGG - Intergenic
1183022031 22:35034979-35035001 CAGGGGGCAAAGGGAGAAGAGGG + Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183172967 22:36201566-36201588 CAGTGAACAAAGCAGGAAGAAGG - Intronic
1183180309 22:36255412-36255434 CAGTGAACAAAGCAGGAAGAAGG + Intronic
1183270311 22:36858196-36858218 CAGGGGGAGAATGAGGCAGAGGG - Intergenic
1183597598 22:38822028-38822050 AGGAGGAAAGAGGAGGAAGAGGG + Exonic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183759448 22:39802653-39802675 AAAGGGAAACAGGAGAAAGAAGG + Intronic
1183784865 22:40023437-40023459 GAGGGGAAGGAGGTGGAAGAGGG + Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184449723 22:44575799-44575821 GAGGAGAAAGAGGAGAAAGAAGG + Intergenic
1184449778 22:44576025-44576047 GAGGGGGAAAAAGAGGAGGAGGG + Intergenic
1184563933 22:45279968-45279990 GAGGGGAAACAGGAGAAAAAGGG - Intergenic
1184746842 22:46461156-46461178 GAGGGAAAAGGGGAGGAAGAGGG + Intronic
1184749230 22:46474729-46474751 GAGGTGAGGAAGGAGGAAGAGGG - Intronic
1184819652 22:46900035-46900057 GAAGGAGAAAAGGAGGAAGAAGG - Intronic
1185157882 22:49205183-49205205 CATGTGAAAGGGGAGGAAGATGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949098997 3:120392-120414 AGGGGGAAAAGGGATGAAGAAGG + Intergenic
949163559 3:910516-910538 AAGGGCAAAGAGGAGGTAGAAGG + Intergenic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
949922669 3:9015190-9015212 AAGGGGAAAATGGAGCAAAAGGG - Intronic
949976976 3:9469981-9470003 GAAGGGAAAAAGGTGGAGGAAGG - Intronic
949996427 3:9620833-9620855 CAGAGAAAAAAGGAGACAGAAGG - Intergenic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950401525 3:12772731-12772753 CAGCAGAAAAATGTGGAAGAGGG + Intergenic
950939588 3:16879779-16879801 CGGGGGAAAAAGGATAAAAAGGG + Intronic
950962921 3:17124036-17124058 AAGAGGAAAGATGAGGAAGAAGG + Intergenic
951071731 3:18337235-18337257 TAGGGGTAAAGGGAGGGAGAAGG - Intronic
951329404 3:21347883-21347905 CAGAGGAGAAAGGTGTAAGAAGG - Intergenic
951370606 3:21842316-21842338 TGGGAGAAAAAGGAGCAAGATGG + Intronic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951680337 3:25288232-25288254 CTGGAGAGAAAGGAGGAAAATGG + Intronic
951906684 3:27713904-27713926 GAGGGAAAAAAGGAAGAAGGGGG - Intergenic
952273778 3:31857846-31857868 GAGGGAAAGAAGGAGGGAGAGGG + Intronic
952447908 3:33401017-33401039 CTGGGGAGAAAGGAGAAAGAAGG + Intronic
952480701 3:33758873-33758895 AGGAGGAAAAAGGAAGAAGATGG + Intergenic
952523526 3:34185903-34185925 CAGGGGAAAAAGAGAGAAAAAGG + Intergenic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
953244048 3:41174840-41174862 GAGGGGAAGAAGGAGGGAGTGGG + Intergenic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
953805395 3:46063574-46063596 CAGGTGGAAAAGGTGGAAGGTGG + Intergenic
953828756 3:46277424-46277446 AAGGGGAAAAGGGTGGGAGAAGG - Intergenic
953926328 3:46984490-46984512 CATGGGATGAAGCAGGAAGATGG - Intronic
954034559 3:47844247-47844269 CTGGAGAAAGACGAGGAAGAGGG + Intronic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954367400 3:50154007-50154029 AAGGAGGAAAAGGAGGGAGATGG + Intergenic
954689805 3:52389652-52389674 CAGGGTAGGAAGGAGGCAGAAGG - Intronic
955007851 3:54986551-54986573 GGGGGAGAAAAGGAGGAAGAAGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955316127 3:57940672-57940694 CAGATTAAAAAGGGGGAAGAAGG + Intergenic
955648192 3:61163523-61163545 CAGGGGAAAAGTGTGGGAGAAGG - Intronic
955670234 3:61394384-61394406 GAGGGGGAAAAGGAGGGGGAGGG + Intergenic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
956088207 3:65636109-65636131 CCGGGGCAGAGGGAGGAAGAGGG + Intronic
956268052 3:67420131-67420153 CAGGAGAAAAATGGGGAAAATGG + Intronic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
956575523 3:70748549-70748571 GTGGGGAAACAAGAGGAAGAGGG - Intergenic
956846536 3:73188825-73188847 GAGGGGGAGGAGGAGGAAGAAGG - Intergenic
956998600 3:74856874-74856896 CAGGGGAAAAAAGAGAGTGAGGG + Intergenic
957104772 3:75872703-75872725 AAGATGAAAAAGGAGTAAGAGGG + Intergenic
957150485 3:76480021-76480043 AAATAGAAAAAGGAGGAAGAAGG + Intronic
957314500 3:78559869-78559891 CATGGAATAAAGGAGCAAGAAGG + Intergenic
957568343 3:81913428-81913450 CAGGAGGACAAGGATGAAGAGGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957843694 3:85703171-85703193 CAAGTGAAAAGGCAGGAAGAAGG + Intronic
958077599 3:88702944-88702966 GAAAGGAAAAAGTAGGAAGAAGG - Intergenic
958196804 3:90251644-90251666 CCGGAGAAATAGGAAGAAGAGGG + Intergenic
958420229 3:93921512-93921534 CGGGAGAAATAGGAAGAAGAGGG + Intronic
958536608 3:95412012-95412034 GAGAGGACAGAGGAGGAAGAAGG - Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958711624 3:97723673-97723695 AAGGGGAAAAAAGAGGATGGAGG + Intronic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
959784442 3:110276754-110276776 AAGAGGAGAAAGGTGGAAGAGGG - Intergenic
960361850 3:116722226-116722248 AGGAGGAAAGAGGAGGAAGAAGG + Intronic
961008423 3:123420415-123420437 CAGGAGGAAAAGGAGAAAGGAGG - Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961251677 3:125511942-125511964 TACAGGAAAAATGAGGAAGAAGG + Intronic
961416577 3:126763281-126763303 AGGGGGAAAAAGGGAGAAGAGGG - Intronic
961504012 3:127358239-127358261 CAGGGGAAAGAGGAGGCAAGGGG - Intergenic
961820063 3:129571393-129571415 CAGAGGCAGAGGGAGGAAGAGGG + Intronic
961997259 3:131259209-131259231 CAGGAGGAAAAGGAAGAAGATGG - Intronic
962174451 3:133138355-133138377 CAGGAGAAAAAGGAGTGAAAAGG + Intronic
962320788 3:134388775-134388797 AAGGGAAGAAAGGAAGAAGATGG + Intergenic
962355269 3:134688679-134688701 CAGGAGCAAAAGTGGGAAGAAGG + Intronic
962360004 3:134731813-134731835 AAAGGGAAAAAGGGAGAAGAGGG + Intronic
962389882 3:134962592-134962614 CAGGGGCAGAAGGAGACAGATGG - Intronic
962408865 3:135123900-135123922 AAGAGGATAAAGGTGGAAGAAGG - Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963473688 3:145776523-145776545 CAGAGGAAGAGGGAGAAAGAGGG - Intergenic
963627159 3:147688386-147688408 CAGGAGAAAAAGAAGCTAGAGGG + Intergenic
963637020 3:147810906-147810928 CAGGGGAAAGGGGTGGGAGAAGG + Intergenic
963909002 3:150799205-150799227 CCAGTAAAAAAGGAGGAAGACGG - Intergenic
964063823 3:152557684-152557706 AAGAAGAAAAAGGAGGGAGAAGG + Intergenic
964236450 3:154535971-154535993 AAGAAGATAAAGGAGGAAGAGGG - Intergenic
964238023 3:154557127-154557149 CAGGGGAGAAAGGTAGGAGAAGG + Intergenic
964317130 3:155456797-155456819 CAGGTGAAAAAGGTGGGAAAGGG - Intronic
964317201 3:155457230-155457252 GCTGGGAAAAAGGAGGATGATGG + Intronic
964444597 3:156745446-156745468 GAAGGGAAAGAGGAGGAAGCAGG - Intergenic
964473515 3:157078222-157078244 TAAGGGATAAAGGTGGAAGAGGG - Intergenic
965023890 3:163273035-163273057 GAAGAGAAATAGGAGGAAGAAGG + Intergenic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965183795 3:165437378-165437400 CAGGGGAGAAAAGTGGTAGAAGG + Intergenic
965338556 3:167457928-167457950 TGGGGGATAAATGAGGAAGAGGG + Intronic
965512374 3:169582401-169582423 CAGGAGGAAAAAGAGGGAGATGG + Intronic
965524525 3:169702004-169702026 AAAGGAAAAGAGGAGGAAGAAGG - Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
965991087 3:174818836-174818858 CAGGGGGAAAGGGAGGGAGTGGG + Intronic
966002788 3:174971049-174971071 CAAGAGAAAAATGAGGAAGAAGG + Intronic
966065208 3:175813186-175813208 CAGGAGGAAAAGGAGAATGATGG + Intergenic
966177973 3:177160063-177160085 GTGGGGAAAATGGAGCAAGAGGG + Intronic
966212146 3:177464442-177464464 CAGAGGACAAAGCAGGAAAAGGG - Intergenic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966585481 3:181619381-181619403 GAAGGGAAAAAGGTGGGAGAAGG + Intergenic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
967274301 3:187758816-187758838 AGGGGGAAGAAAGAGGAAGAAGG - Intergenic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
967337195 3:188357852-188357874 AAGGAGTAAAAGGAGGCAGAAGG - Intronic
967856286 3:194119954-194119976 CAAGGGGAAGAGGAGGGAGATGG - Intergenic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968084830 3:195869587-195869609 CAGAGGACAAAGGAGGGAGACGG + Intronic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969383186 4:6821368-6821390 CAGGGGGAAAGGGTGGGAGACGG - Intronic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969651156 4:8469130-8469152 AAGAGGACAAAGGATGAAGAAGG - Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970563831 4:17311399-17311421 AAAGGGGAAAGGGAGGAAGAGGG + Intergenic
970709591 4:18846317-18846339 CAAGGGTAAGAGTAGGAAGATGG + Intergenic
970822376 4:20232876-20232898 CAGGGGAGAAGGGAGGAATGAGG - Intergenic
970835345 4:20398287-20398309 CAGAGGCAAAATGAGGAAAAGGG + Intronic
970914891 4:21321580-21321602 GAGGGGTAGGAGGAGGAAGAGGG + Intronic
971162189 4:24144689-24144711 AAGGGGAAAGTGGAGGGAGAAGG - Intergenic
971303024 4:25457305-25457327 CAGGGGAAAAAGCGGTAAGGAGG - Intergenic
971430938 4:26566603-26566625 CAGGGAAGAATGTAGGAAGAAGG - Intergenic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971570952 4:28210028-28210050 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971570959 4:28210046-28210068 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971655249 4:29336003-29336025 TAGAAGAAAAAGGAGGAAGGAGG - Intergenic
972103277 4:35448048-35448070 AGAAGGAAAAAGGAGGAAGAAGG + Intergenic
972368071 4:38394500-38394522 CAGGGGACAAAGAAGGAAAGGGG + Intergenic
972369950 4:38413746-38413768 CTGGGGAGGAAGGAGGAAGTTGG - Intergenic
972371549 4:38428774-38428796 CAAGAGAAAGAGGATGAAGAAGG + Intergenic
972491086 4:39587749-39587771 CAAAGAAGAAAGGAGGAAGAAGG + Intronic
973128403 4:46618250-46618272 AAAGTGAAAAAAGAGGAAGAAGG + Intergenic
973178622 4:47240888-47240910 AAGAGGAAAAATGGGGAAGAAGG - Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973981932 4:56314703-56314725 CTGGGGGAAGAGGAGGAGGAGGG + Exonic
974169612 4:58249451-58249473 CAGGGAAAAAAGGAACAAAAGGG + Intergenic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
974374172 4:61055360-61055382 CAGGGCAGAAATGAGCAAGAAGG + Intergenic
974803688 4:66852881-66852903 CAAGGAGAAAAGGAGAAAGAAGG + Intergenic
975397001 4:73887049-73887071 CAGGGGAAAAGGGTGGGAGGGGG + Intergenic
975711531 4:77164865-77164887 CAAGGGAAATAGGAGAAAGATGG - Intronic
976575348 4:86663527-86663549 CAGAGGAAAAGGGTGGGAGAAGG + Intronic
976795919 4:88932381-88932403 CAGGGGCAAAAGGGAGAATAGGG - Intronic
977088031 4:92629513-92629535 AAGGGGAAAGAGGTGGAAAATGG + Intronic
977372992 4:96163949-96163971 CAGGGGACAGGAGAGGAAGAAGG + Intergenic
977459496 4:97307705-97307727 CAGGGGAGAGGAGAGGAAGAAGG + Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978133342 4:105226637-105226659 GAGAGGAAGAGGGAGGAAGAGGG - Intronic
978179982 4:105782195-105782217 AAAAGGAAAAAGGAGAAAGACGG + Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978618995 4:110621330-110621352 CAGGGGAAGAATGAGGACGTGGG - Exonic
979320201 4:119314633-119314655 GAAGGGAAAAAGGAGGTAGATGG - Intergenic
979532843 4:121787438-121787460 GAGTGGGAAAAGGATGAAGATGG - Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980104947 4:128578688-128578710 GACGGGAAAGACGAGGAAGAGGG + Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980223583 4:129951174-129951196 AAAGGAAAAAAGGAAGAAGAAGG + Intergenic
980263512 4:130485107-130485129 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980347269 4:131636747-131636769 AAGGGGAGAGAAGAGGAAGAAGG + Intergenic
980366388 4:131809511-131809533 AGGAGGAAAAAGGAGAAAGAAGG + Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
981197181 4:141935078-141935100 CAGGAGGAAAAGGGAGAAGATGG + Intergenic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
982132066 4:152238509-152238531 CAGGGGAAAAATGGAAAAGAGGG + Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982624107 4:157743586-157743608 AAGGGGAGAAGGGAGAAAGAAGG + Intergenic
983184170 4:164682242-164682264 CATGGGAAAAGGGCGTAAGATGG - Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983523415 4:168734943-168734965 GAGGAGAAAGAGGAGGGAGAGGG + Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
985026481 4:185744045-185744067 AAGGGGGAGAAGGAGGAAGAAGG - Intronic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985402541 4:189606730-189606752 GAGAGGGAGAAGGAGGAAGATGG - Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
986078716 5:4366544-4366566 TACGTGAAAAGGGAGGAAGAAGG - Intergenic
986085244 5:4438274-4438296 CAGGGAAGAAAAGAAGAAGAAGG + Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986722257 5:10567734-10567756 TAGGGGAAAGAGGAGTTAGACGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987257672 5:16173188-16173210 CAAGCAACAAAGGAGGAAGAAGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987436373 5:17898977-17898999 CAGTGAAAAAGGGAGAAAGAAGG - Intergenic
987455142 5:18134932-18134954 AAGGAGGAAAAGGAAGAAGAGGG - Intergenic
987588093 5:19885060-19885082 CAGTGGAAAAAGGAAGCAGGAGG - Intronic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987865363 5:23528954-23528976 CAGAAGAAAAAGGAGAAAGGAGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988276347 5:29085585-29085607 CAGAGGAAATAGGAGGGAGGGGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988887677 5:35575857-35575879 CAGGAGAAAAGGGAGAAAAAGGG + Intergenic
988899513 5:35717608-35717630 AAGGGAAAAAAAGAGGAAAACGG + Intronic
989092754 5:37751061-37751083 CAGGGGGAAAAAAAGGAACAAGG - Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989270517 5:39527463-39527485 CAGGTAAAAAACGATGAAGAAGG - Intergenic
989417360 5:41195382-41195404 CAGGAGCAAATGGAGAAAGAGGG - Intronic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990024426 5:51167997-51168019 TGGGGGAAAAAAAAGGAAGAAGG - Intergenic
990317953 5:54601801-54601823 CAGGTGAGAAATGAGGAAGAAGG - Intergenic
990443528 5:55870549-55870571 AAGGGAAAGATGGAGGAAGAGGG - Intronic
990501340 5:56399486-56399508 ACAGGGAAAAAGGAGTAAGATGG + Intergenic
990755864 5:59069184-59069206 GAGAGGTATAAGGAGGAAGATGG - Intronic
991482175 5:67092543-67092565 CAGGGAAAAAAGGATTAAGTAGG - Intronic
991605440 5:68396138-68396160 CAGTGGAAGAATGAGGAAGGGGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
991957711 5:72012437-72012459 CATGGGTTAGAGGAGGAAGAGGG - Intergenic
992024260 5:72654939-72654961 GAGGGAAAAGAGGAGGAAAATGG - Intergenic
992088811 5:73300065-73300087 CGGGAAAAAAAAGAGGAAGAAGG + Intergenic
992090639 5:73312925-73312947 GAGGAGGAGAAGGAGGAAGAAGG - Intergenic
992145142 5:73839401-73839423 AAGGGGAAAAAGAAGCAAAAGGG - Intronic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992152238 5:73916529-73916551 CAGGTGAAGACGCAGGAAGAAGG - Intronic
992492888 5:77262203-77262225 CAGGGCAAAAAGGCAGAAAATGG + Intronic
992660752 5:78958331-78958353 AAGGAGAGAAAGGAGAAAGAGGG + Intronic
992941441 5:81766302-81766324 TGGAGGAAAAAGGAGGAAGGAGG + Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993352987 5:86872774-86872796 TAGGGGAAAAGGGAGCTAGAAGG + Intergenic
993491205 5:88552260-88552282 CAGGGGAGAAGGGAGGGTGATGG - Intergenic
993583328 5:89691974-89691996 GAGGGAAAGAAGGAGAAAGAGGG - Intergenic
994254984 5:97582014-97582036 CAGGGGAGAAGGGTGGGAGAAGG + Intergenic
994374408 5:99002833-99002855 AAGGGGAGAAGGGAGGTAGATGG + Intergenic
994513693 5:100742255-100742277 CTGGGGGAAAAGGAGGGAGGGGG + Intergenic
994643392 5:102438404-102438426 AATGGGATAAAGGAGGAACACGG + Intronic
994724015 5:103413652-103413674 CAAGGGAAAAAGGAGACAGGAGG - Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995068559 5:107890823-107890845 CAGAGGAAAAGGGAAGAACATGG + Intronic
995109627 5:108414475-108414497 AAGGGGAAAAGGGAGGGGGATGG - Intergenic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
995291588 5:110462500-110462522 CACGGGAGAAAGGAGGAGGCTGG - Intronic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995337993 5:111024577-111024599 CTGGGGAAAAAGGAGGTAGGAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995482412 5:112606321-112606343 GAGGTGAAAAAGCAGGAACAAGG + Intergenic
995502556 5:112823454-112823476 CTGGGGCAAAAGGAGGATTAGGG + Intronic
995547995 5:113252075-113252097 CAGGGATAAATGGAGGAATAGGG - Intronic
995652450 5:114385198-114385220 CAAGAGAAAAAAGAGGAAGATGG - Intronic
995772096 5:115681905-115681927 GAAGGGAAGAAGCAGGAAGAAGG - Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
995909469 5:117168317-117168339 CAAGGGACAAAGGAGAAAGTAGG + Intergenic
996075218 5:119185093-119185115 CAGAGGAAAGAAGGGGAAGAAGG - Intronic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996831163 5:127742077-127742099 CAGGGAAATAAGGAGTAACAAGG - Intergenic
997022976 5:130023806-130023828 GAGAGGAAAAATGAGTAAGACGG + Intronic
997565467 5:134882825-134882847 CCGTGGAAAGAGGAGGGAGAGGG + Intronic
997804624 5:136905001-136905023 GAAAGGAGAAAGGAGGAAGAAGG - Intergenic
997895728 5:137715148-137715170 AAAGTGCAAAAGGAGGAAGAAGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998391282 5:141788536-141788558 TAGGAGAAAAAGGAGGAGGTGGG - Intergenic
998409444 5:141898132-141898154 CAGGAAAGAAAGGAGGGAGAAGG - Intergenic
998613249 5:143712149-143712171 CAGGGTAATAAGGAAGCAGAGGG - Intergenic
998874523 5:146586026-146586048 CAGGGGGAAGAGGTGGATGAAGG + Intronic
999039453 5:148390882-148390904 AGGAAGAAAAAGGAGGAAGAAGG + Intronic
999076861 5:148804535-148804557 GAGGGGAAAAAGGAGCAAGTTGG + Intergenic
999126735 5:149251568-149251590 CAGGGGAAAAGGGAGGGGGTGGG - Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
999499571 5:152133123-152133145 CAGAGGGAAAATGAGGAACAAGG - Intergenic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000230118 5:159307951-159307973 CTTGGAAAAAAGGAGCAAGAAGG + Intergenic
1000232973 5:159332448-159332470 GAGCGGAAAAGGGAGGATGAGGG - Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000419312 5:161020348-161020370 CAGAGGACAAAGGACGGAGAGGG - Intergenic
1000444181 5:161299644-161299666 AAGGAGGAAGAGGAGGAAGAGGG - Intronic
1000673703 5:164093861-164093883 AAGAGAAAAAATGAGGAAGAGGG - Intergenic
1000692425 5:164340010-164340032 GAGAAGAAAAAGCAGGAAGAGGG + Intergenic
1000713994 5:164617595-164617617 CAGGAGAAATAGCAGGAAAAGGG + Intergenic
1000741301 5:164973436-164973458 AGGAGGAAAAAGGAGAAAGAAGG + Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1001132903 5:169079536-169079558 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001375273 5:171250727-171250749 AAGGGGAAAAAAGACAAAGAAGG + Intronic
1001401190 5:171447404-171447426 AAGGGGAACAAGGAGGATCAAGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001724890 5:173888448-173888470 GAGGAGGAAGAGGAGGAAGAAGG + Exonic
1001738056 5:174023178-174023200 TGGGGGAAAAAAGAGGTAGACGG + Intergenic
1001786273 5:174416503-174416525 CTGGTGAAAAAGGAGGAATTGGG + Intergenic
1001804422 5:174571068-174571090 CAGGGGTAAAAGGGAGGAGATGG - Intergenic
1001876477 5:175206157-175206179 CAGAGGAGAAAGGTGGAAAAGGG + Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002137413 5:177116543-177116565 CAGGAGGAAGATGAGGAAGAGGG + Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002310895 5:178313149-178313171 CAGGGGCAGAAGGTGGAATAGGG + Intronic
1002787490 6:414666-414688 CAGGAGCAGAAGGAGGAAGTGGG - Intergenic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1002959343 6:1899114-1899136 GATGGAGAAAAGGAGGAAGAGGG - Intronic
1003162923 6:3651326-3651348 CGGGGGAAAAGGGAGGGAGGAGG + Intergenic
1003380954 6:5624342-5624364 CAGGGCAACAAGGAGGAACAAGG - Intronic
1004127391 6:12887014-12887036 CAAGGGGAAGAGGAGGAAGAGGG - Intronic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1004635419 6:17462974-17462996 CCTGGGAACAAAGAGGAAGATGG - Exonic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004899514 6:20181392-20181414 GAGGGGAAGAAGAAGGCAGAAGG - Intronic
1005010298 6:21329338-21329360 CAGGGGAAAAGGGAGGGAAAAGG - Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005349016 6:24916131-24916153 CTGAGGAAAAAGGTGGAAGCAGG - Intronic
1005646919 6:27848265-27848287 TAGGAGAAAAAGCAGGAGGAGGG - Intronic
1005896928 6:30186321-30186343 GAGGGGGATGAGGAGGAAGAGGG - Exonic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1005943061 6:30575536-30575558 CAGGGAAACAAGGATGGAGAGGG + Intronic
1005970025 6:30753466-30753488 CAGGAGAATAGGGAGGAAAAAGG - Intergenic
1006069932 6:31490911-31490933 CAGAGGAAGAAGGAGCACGAGGG - Intergenic
1006165420 6:32061776-32061798 CGTGGGGAAAAGGAGGGAGAAGG + Intronic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006268558 6:32945882-32945904 CACGAGAAAATGGAGGCAGAGGG + Intronic
1006662640 6:35660999-35661021 TAGGGGAAACAGGAGGAAATGGG + Intronic
1007085458 6:39141208-39141230 TAGGGGACATGGGAGGAAGAGGG + Intergenic
1007161961 6:39798824-39798846 CAAGGGAATAAGGAGGAAAAGGG - Intronic
1007333755 6:41136256-41136278 AAGGGGACAAGGGAGGAAGCAGG + Intergenic
1007482333 6:42158348-42158370 GAGGTGGAAGAGGAGGAAGAGGG - Intronic
1007617396 6:43188254-43188276 CAAGGTCAAAAGGAAGAAGATGG - Intronic
1007667915 6:43526840-43526862 CAGGTGAGGAAGGAGGAAGATGG + Intronic
1007712749 6:43835035-43835057 CAGGGGACAATGGAGGAGGTAGG + Intergenic
1008277624 6:49559752-49559774 AAGAGGAAAAAGGAGGCATAAGG + Intronic
1008380936 6:50839216-50839238 CAGGGGAGAAGGGAGGAAACTGG + Intronic
1008503610 6:52207959-52207981 CTGGGGAAATAAGAGAAAGAAGG - Intergenic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1008805729 6:55425391-55425413 CAGGGGAAAATGGAGGAATCTGG - Intergenic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1008902742 6:56640762-56640784 CAGGGGAAGAGGGAGGTATAAGG + Intronic
1009593738 6:65708771-65708793 AATGGGGAAAAGGAGGAGGAAGG - Intergenic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009735710 6:67674087-67674109 GAGAGGACAAAGGAGGAAAAAGG + Intergenic
1009825906 6:68865870-68865892 CATGGTGGAAAGGAGGAAGAAGG - Intronic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1010275401 6:73962948-73962970 AAGGGGAAAAAGCAGGCAGGAGG + Intergenic
1010414607 6:75599647-75599669 GAGGGGAAAGAGGAGAGAGAAGG + Intergenic
1011417446 6:87137328-87137350 GAGGAGAAAGAGGAGAAAGAGGG - Intergenic
1011518804 6:88181845-88181867 CAGGGGAGAAGGGTGGGAGAAGG + Intergenic
1011993241 6:93550557-93550579 CAGGGGAAATGGGAGGTAAAGGG + Intergenic
1012088358 6:94858949-94858971 TAGGGGAAAAAGCAGAAAGAGGG + Intergenic
1012121192 6:95368648-95368670 AAGGGGAAAGAAGAGGAAGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012143771 6:95656003-95656025 AAGGCCAAAAAGTAGGAAGAAGG + Intergenic
1012143837 6:95656717-95656739 CTCAGGAAAAAGGAGGAAGGTGG - Intergenic
1012646188 6:101684949-101684971 CAGGGGAGAAAGGTGGGATAAGG + Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013053861 6:106564133-106564155 CTGGGGAGAAAAGAGGGAGAGGG - Intronic
1013335427 6:109154267-109154289 GGAGGGAAAAAGGATGAAGAGGG - Intronic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1013941266 6:115666182-115666204 CTGGGTAGAAAGGAGGCAGAGGG - Intergenic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014016576 6:116537778-116537800 GAGGGGAGGAAGGAGAAAGAAGG - Intronic
1014208721 6:118685807-118685829 AAGGAGAAAAAGGAGGAAAAAGG + Intronic
1014554715 6:122831635-122831657 CAGGGTAGAAAGGTGGAAAAAGG - Intergenic
1014650111 6:124025880-124025902 CAGGGGAGAAAGGCAGGAGAAGG - Intronic
1014743208 6:125169881-125169903 CAGGAAATAAAAGAGGAAGAAGG - Intronic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014905419 6:127020686-127020708 GATGAGAAAAAAGAGGAAGAAGG - Intergenic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015472765 6:133624645-133624667 GTCAGGAAAAAGGAGGAAGAGGG - Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015701021 6:136036409-136036431 CAGGTGAAGAAGGGGCAAGAGGG - Intronic
1015836522 6:137426122-137426144 CAGGGGAGGAAGGTGGAATAAGG + Intergenic
1015907948 6:138136763-138136785 CAGTGGAGAAAGGAGTGAGAGGG + Intergenic
1016027100 6:139298927-139298949 CATGGCAAGAGGGAGGAAGAAGG - Intergenic
1016341938 6:143071740-143071762 GAAGAGAAGAAGGAGGAAGAGGG - Intronic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016771432 6:147856716-147856738 GACGGTTAAAAGGAGGAAGATGG - Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017381846 6:153840276-153840298 CAGGGGACAAAGCAATAAGAAGG - Intergenic
1017462958 6:154668365-154668387 AGGAGGAGAAAGGAGGAAGAAGG + Intergenic
1017616322 6:156250406-156250428 AAGGGAAGGAAGGAGGAAGAAGG - Intergenic
1017681198 6:156865811-156865833 AAAAGGAAAAAGGAGGAAGGTGG - Intronic
1017772341 6:157652910-157652932 AAGGGGAGAGAGGAGGAAGGGGG + Intronic
1017849727 6:158294704-158294726 AAGAAGAAAAAAGAGGAAGAAGG - Intronic
1017870130 6:158479994-158480016 CAGGTGAGGGAGGAGGAAGAGGG - Intronic
1018133603 6:160756162-160756184 CAGGAAGAAATGGAGGAAGAGGG - Intergenic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1018415943 6:163602133-163602155 GAGGACAAAGAGGAGGAAGAGGG + Intergenic
1018433280 6:163740295-163740317 TAGGGGAGAAAGGAGCCAGAAGG + Intergenic
1018486535 6:164246173-164246195 TAGGTGAAAAGAGAGGAAGAAGG - Intergenic
1018570946 6:165209356-165209378 CACTGCAAAAATGAGGAAGATGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018757564 6:166862982-166863004 CAGGAGAAGAGGGACGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019147372 6:169983977-169983999 AAGGGACAAAAGGAGGCAGAAGG - Intergenic
1019535385 7:1526534-1526556 GAGGGGGAAGAAGAGGAAGAGGG + Intergenic
1019660130 7:2219589-2219611 CAGAGGAATAAGGGGGCAGAGGG + Intronic
1019732826 7:2637179-2637201 CAGGGGTCAGGGGAGGAAGAAGG - Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019903651 7:4043956-4043978 AAGGAGAAAAAGGAAGAAAAGGG - Intronic
1020466118 7:8481819-8481841 CAGGGGAGGAAGGAGGGAGTGGG - Intronic
1020657159 7:10941163-10941185 CAGGTGAAAACGGAGGATGCAGG + Intergenic
1020786027 7:12573379-12573401 AAGGGGAAACAGGAAGAAGTTGG + Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021028173 7:15695319-15695341 CAGGGGGAAAAAGAGGTGGAGGG + Intergenic
1021132687 7:16930153-16930175 AAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1021152619 7:17169650-17169672 CAGGGGAGAAAGGTAGGAGAAGG - Intergenic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021301635 7:18980697-18980719 AAGAGGAAGAAGGAAGAAGAAGG - Intronic
1022037238 7:26546037-26546059 CAGAGGAAAAAGTAGCCAGATGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022303802 7:29127641-29127663 CAGGAGAAAAAGGTGGGAAAAGG - Intronic
1022306709 7:29153454-29153476 GAGGAGAAGAAGGAAGAAGAGGG - Intronic
1022321601 7:29293275-29293297 CAGGGGAAAATCGAGGATGCAGG - Intronic
1022473329 7:30694853-30694875 AAGGGAAGAAAGGAGGAAGGAGG + Intronic
1022833342 7:34090356-34090378 GAGATGAAAAAGGAGAAAGAAGG - Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024160158 7:46665939-46665961 CAGGGGAAATGGTAGGAAGGCGG - Intergenic
1024233080 7:47377692-47377714 GAGGGGGAAAAAGAGGAAGAGGG - Intronic
1024846255 7:53646173-53646195 AAGGAGGAGAAGGAGGAAGAAGG - Intergenic
1025174653 7:56792490-56792512 CAAGATAAAAAGGAGGAAGACGG + Intergenic
1025697150 7:63783924-63783946 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025826902 7:65018035-65018057 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025832814 7:65068764-65068786 CAGAGCTAAAAGGAGGAATATGG + Intergenic
1025873098 7:65453344-65453366 CAGGGGAAAATGGAGTAGAAGGG + Intergenic
1025902586 7:65758291-65758313 CAGAGCTAAAAGGAGGAATATGG + Intergenic
1025914448 7:65854453-65854475 CAAGATAAAAAGGAGGAAGACGG - Intergenic
1025975223 7:66364331-66364353 CAAAATAAAAAGGAGGAAGATGG + Intronic
1026159053 7:67852801-67852823 CAGGAAAAGAAGGAAGAAGAGGG + Intergenic
1026188558 7:68103521-68103543 AAGGAGGGAAAGGAGGAAGAAGG + Intergenic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026291934 7:69015083-69015105 CAGGGGAGAAAGGTGGGAGAAGG - Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026679013 7:72451260-72451282 GAGGAGGAGAAGGAGGAAGAAGG + Intergenic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1027457434 7:78410698-78410720 CAGGGAGAAAAAGAGTAAGATGG + Intronic
1027660381 7:80981461-80981483 CTGGGTAAAAAGGAAGAAAAGGG + Intergenic
1027888160 7:83936037-83936059 AAGGGGAAGAAGGAGGACAAAGG - Intergenic
1027928448 7:84498813-84498835 CAGGGCAGAAAGTAAGAAGATGG - Intergenic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028465489 7:91146850-91146872 CAAAGAAAAAAGGAGGCAGATGG - Intronic
1028620013 7:92815068-92815090 AATGGAAAAAGGGAGGAAGAAGG + Intronic
1028810795 7:95083379-95083401 CAAGGGAGAAGGGAGGGAGAAGG + Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029187282 7:98748270-98748292 AAGGAGAGAAAGGAGAAAGAGGG + Intergenic
1029455417 7:100668438-100668460 AGGGGGAAGAAGGAAGAAGATGG + Intergenic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1029995135 7:105000530-105000552 GATGGAAAAAAGGAGGAGGATGG + Intergenic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1030505738 7:110419960-110419982 CACAGGAAAAAGTATGAAGATGG - Intergenic
1030535375 7:110759908-110759930 CAGGGGTAAAAGGAGTAACTGGG - Intronic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1031399136 7:121310642-121310664 CAGGAGAAAAAAGTGGGAGAAGG + Intergenic
1031467100 7:122126153-122126175 CAAAGGAAAAAGCAGGGAGAAGG - Intronic
1031630201 7:124034481-124034503 CGGGGGAAGGAGGAGAAAGAGGG - Intergenic
1031704581 7:124963998-124964020 CAGGGGAAAAATGGAGAAGCTGG - Intergenic
1031871460 7:127092706-127092728 CAGGGGGAAAAGAAAAAAGAAGG + Intronic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032122816 7:129169163-129169185 ACGGGGAATGAGGAGGAAGAAGG + Intronic
1032179706 7:129664142-129664164 GAGGGGGAAAGGGAGGGAGAGGG + Intronic
1032182458 7:129692074-129692096 CAGGGGAATGTGGAGGGAGAGGG - Intronic
1032185382 7:129720649-129720671 TTGGGGAATAAGGAGGCAGAGGG + Intronic
1032630421 7:133645010-133645032 CAGGTGAAGGAGGAGGAAAAGGG - Intronic
1033041713 7:137925197-137925219 GAGGGGAAGCAGGAGGCAGAGGG + Intronic
1033230213 7:139591481-139591503 ACAGGGAAGAAGGAGGAAGAGGG - Intronic
1033664637 7:143428886-143428908 TATGGGAAAAAGGAGAAACAGGG + Intergenic
1033666256 7:143443517-143443539 CAGGCGTAAAAGGAGTAAAATGG - Exonic
1033999358 7:147392503-147392525 CAGGGAAGAAAGGTGGGAGAGGG - Intronic
1034168277 7:149042643-149042665 GAGGGGGGAGAGGAGGAAGAGGG + Intergenic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034286694 7:149888647-149888669 CAGGGAAGGAAGGAGGAAGTGGG + Intergenic
1034353380 7:150431942-150431964 AAGGGGGAAAAGGAGTGAGAAGG + Intergenic
1034360707 7:150495064-150495086 CAGGGGAAATAGGCAGGAGAAGG + Intergenic
1034447054 7:151119096-151119118 TGTGGGAAAAAGGAGGAGGAGGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034647457 7:152661454-152661476 AAGGGGACAAAGGAGAAAGGTGG + Intronic
1034868155 7:154658270-154658292 CAGGGGAAGAAGGAGGATATGGG + Intronic
1034921597 7:155087768-155087790 CAGGAGGAGAAAGAGGAAGATGG - Intergenic
1035143342 7:156786292-156786314 GAGGGGAAAAAAGAAGAAAAAGG + Intronic
1035146979 7:156828875-156828897 AAAAGGAAAAAGGAGGAAAAGGG - Intronic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419718 7:158717432-158717454 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419745 7:158717571-158717593 GAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035495991 7:159326607-159326629 CAAAGGGAAAAGGGGGAAGACGG - Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1035970579 8:4243413-4243435 CAGGGGAACAAGGAGCAAAGTGG - Intronic
1036147916 8:6271825-6271847 CAGGGGGAAAATGAGGAAAGCGG - Intergenic
1036256123 8:7208131-7208153 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036361361 8:8079368-8079390 CAGGTGAAGAAGCAGGGAGAGGG - Intergenic
1036603304 8:10283585-10283607 AGGGGGAAAGAGGAGGAAGGGGG - Intronic
1036623345 8:10443844-10443866 CAAGAGAAAAAGGAGGAACAGGG + Intergenic
1036665389 8:10734059-10734081 GAGGAGAAGAGGGAGGAAGAGGG + Intronic
1036889613 8:12587655-12587677 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036985533 8:13524985-13525007 GAAGGGAGAAAGGAGCAAGAGGG - Intergenic
1037017642 8:13928403-13928425 CCGGGGAAAAAGGTGGGAGAAGG + Intergenic
1037165138 8:15817973-15817995 AATGGAAAAAAGGAGGAAGCTGG + Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037855865 8:22370246-22370268 CAGGTAAGGAAGGAGGAAGAAGG - Intronic
1038085911 8:24195928-24195950 CAGGGGTAGAAGGAGGATGTGGG + Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038625944 8:29193323-29193345 GAGGAGCAAAAGGAGGAGGATGG + Intronic
1038664555 8:29526900-29526922 CAGGTGAAGAGGGAGGAAGAGGG - Intergenic
1038980471 8:32753905-32753927 GAGGGGAGGAAGGAGGAAGTGGG + Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039100949 8:33941588-33941610 CACGGAAAAAAGAAGTAAGAAGG - Intergenic
1039102904 8:33959392-33959414 CAGGGAAAAAAGGAGAAAACAGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039714450 8:40092581-40092603 AAGAGGAAAAAGTAGGTAGAAGG + Intergenic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040097137 8:43456946-43456968 CAGGAGAAAAAGCTGGCAGAAGG - Intergenic
1040693774 8:49971512-49971534 CAGGGCAAATAGGCAGAAGAAGG + Intronic
1040857552 8:51963966-51963988 CTGGAGAAAAAGGAGGCTGAGGG - Intergenic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1040987523 8:53312761-53312783 CATGGGAAAATGGAAGAGGAAGG - Intergenic
1041023694 8:53662365-53662387 CAGGGGGAAGAGGAGGAAATTGG + Intergenic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041568006 8:59302730-59302752 GAAGGGAAGAGGGAGGAAGATGG + Intergenic
1041868147 8:62600361-62600383 CAGGGGACAGGGGAGGAAAATGG + Intronic
1042166938 8:65954985-65955007 CTAGGCAAAAAAGAGGAAGAAGG - Intergenic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1042437669 8:68786272-68786294 AAGGGTAAAAAGGAAGGAGAGGG - Intronic
1042785651 8:72544146-72544168 CAAGTGGAAAAGGAGGTAGATGG + Intronic
1042855352 8:73261435-73261457 AAGAGGGAAAAGGAGGAACAGGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043087530 8:75853352-75853374 TAGGGGATAAAGGAGGAGGTTGG + Intergenic
1043099382 8:76021300-76021322 CAGGAGGAAGAGGAAGAAGAGGG - Intergenic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043719440 8:83528541-83528563 AAGGGGCAAAGGGAGGGAGAAGG + Intergenic
1043769278 8:84177489-84177511 CAGGGGAAAAAGAAGGAATTTGG + Intergenic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1045393712 8:101739610-101739632 CAGGGGAGAAAGATGGAAGCCGG - Intronic
1046133181 8:109993426-109993448 AAGGAGAAAAAGGAGAAAGTGGG + Intergenic
1046731155 8:117727795-117727817 CAAGGGAAAAAGGATGAGGGAGG - Intergenic
1046748675 8:117903641-117903663 CTGAAGAAAAAGGAGGAAAATGG - Intronic
1047113652 8:121817751-121817773 AAGGGAAAAAAGGAGAAAAAGGG - Intergenic
1047131263 8:122022698-122022720 GAGGGGAGAAAGGAGAAAGGAGG - Intergenic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047309887 8:123683107-123683129 CTGGAGAGAAAGGAGGGAGAGGG + Intronic
1047815876 8:128461699-128461721 AAAGGGACAAAGGAGGAACATGG + Intergenic
1047866478 8:129029492-129029514 ACGGGGAAGAAGGAGGAAGAAGG - Intergenic
1048231981 8:132651381-132651403 GAGGTGACAGAGGAGGAAGATGG - Intronic
1048374216 8:133808183-133808205 CAGCGGAAAAAGGAAGTTGAGGG + Intergenic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1048983370 8:139715316-139715338 CAGGGCATCAGGGAGGAAGAGGG + Intergenic
1049101145 8:140579964-140579986 AAGACGAACAAGGAGGAAGAGGG + Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049399801 8:142419941-142419963 CAGGAGGAAAAGGAAAAAGAGGG - Intergenic
1049491724 8:142907458-142907480 TAAGGGAAAAAGGAAGAGGAGGG - Intronic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049913879 9:297513-297535 CAGGAGAAAAATGGGGAAGTAGG - Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050038526 9:1463041-1463063 CACAGGGAAAAGGAGGCAGAGGG + Intergenic
1050775088 9:9249605-9249627 AAGAGAAAGAAGGAGGAAGAGGG - Intronic
1050873305 9:10603318-10603340 CAGGGGAACAAAGAAGCAGAGGG - Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051097555 9:13483964-13483986 CAGGAGAAAAAGGAGGCTGTGGG - Intergenic
1051596206 9:18826524-18826546 TAGGGCACAAAGGAGGTAGAGGG - Intronic
1051973926 9:22925576-22925598 GAAGGGTGAAAGGAGGAAGAAGG - Intergenic
1052044278 9:23776171-23776193 AAGGGGAAAAAGGGGAAAGTAGG + Intronic
1052059353 9:23941897-23941919 GAGAGGAAAGAGGAGGAAAAAGG + Intergenic
1052255641 9:26453223-26453245 GAGGGGAAGAAGGAAAAAGAAGG + Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1052974298 9:34400346-34400368 ATGGGGCAAGAGGAGGAAGAAGG + Exonic
1053067354 9:35078078-35078100 CTGGAGAGAAAGGAGGAGGAAGG + Intronic
1053180311 9:35962569-35962591 AAGAGGAAAAAGAAGAAAGAGGG - Intergenic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053464911 9:38298902-38298924 AAAGGGAAAAAGGACTAAGAAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055092221 9:72374559-72374581 CAGGGGATAGAGGGGAAAGAGGG + Intergenic
1055098561 9:72439818-72439840 CAGGGGAAGAAGGAATAATAAGG - Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055752529 9:79522653-79522675 CAGGGGATATAAGAGGGAGAAGG + Intergenic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1055950976 9:81729440-81729462 CAAGGTAAAAAAGAGGAAGCAGG - Intergenic
1055989510 9:82090580-82090602 TAGAGGAAAAAACAGGAAGAAGG - Intergenic
1056011448 9:82335034-82335056 CAGAGGATAATGGGGGAAGAGGG - Intergenic
1056236095 9:84596201-84596223 GAGAGGAGAGAGGAGGAAGATGG - Intergenic
1056513363 9:87327130-87327152 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056703907 9:88935243-88935265 CAGTGGAATTAGGAGGAAGGAGG - Intergenic
1056799298 9:89680374-89680396 GATGGGAAAAAGGTGGAAGCTGG + Intergenic
1056839133 9:89983893-89983915 CAGTGGAAAAGGCAGGTAGACGG + Intergenic
1056879332 9:90375742-90375764 CAAGGGAAAAAGAAAAAAGACGG + Intergenic
1057040954 9:91847073-91847095 CGGGGGGAAATGGGGGAAGATGG + Intronic
1057270974 9:93651367-93651389 CAGTGGAAACAGGAGGCAAAGGG - Intronic
1057394251 9:94665586-94665608 CATGGTAAGAAGGAGGGAGATGG + Intergenic
1057497998 9:95575304-95575326 GAGGAGAAGAGGGAGGAAGAAGG + Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1058557003 9:106179932-106179954 GAGGAAAAAAAGGAGGATGAGGG - Intergenic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058672862 9:107375345-107375367 AAAGGGAGCAAGGAGGAAGAGGG + Intergenic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058787074 9:108399749-108399771 CAGGGGGAAAAGGAAGATAACGG + Intergenic
1059033216 9:110723466-110723488 CAGGGGAAAAGAGTGGAAGGGGG + Intronic
1059033328 9:110725250-110725272 CAGGGGAAAAGAGTGGAAGGGGG + Intronic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059249120 9:112872447-112872469 CTGGTGAGAGAGGAGGAAGAGGG + Exonic
1059428124 9:114233833-114233855 TAGGGGAAAAAAGAGAGAGAGGG + Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059606154 9:115838654-115838676 CATGTGAAAAGGGAGGAAGAGGG + Intergenic
1059693007 9:116703916-116703938 CAGGGCAACAGTGAGGAAGAAGG + Intronic
1059739974 9:117140635-117140657 GAGGAGGAAAAGGAGGAGGAGGG + Intronic
1059968999 9:119645194-119645216 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060218601 9:121752878-121752900 CATCTGAAAAAGGAGGAAGGTGG - Intronic
1060367526 9:123033589-123033611 GAGGGGAAACAGGGAGAAGAGGG - Intronic
1060828336 9:126699035-126699057 CATGTGCAAAAGGAGAAAGAGGG - Exonic
1061061852 9:128254462-128254484 GAAGGGAAAGGGGAGGAAGATGG - Intronic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1062003688 9:134229025-134229047 AAGGGGAGAAAGGAGGAAGGGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062097877 9:134712163-134712185 GAGGGGGGAAAGGAAGAAGATGG - Intronic
1062173493 9:135148255-135148277 CAGGGGACAAGGGAGGGAGGTGG + Intergenic
1203431706 Un_GL000195v1:95708-95730 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688302 X:1948368-1948390 GAGGGGAGAGGGGAGGAAGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185717789 X:2356670-2356692 GAGGAGGAGAAGGAGGAAGAGGG - Intronic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1186045571 X:5532888-5532910 CAGAGGAAGAAGGAGGGAGGGGG + Intergenic
1186046631 X:5543917-5543939 AAGGGGAAGAAGCAGGCAGAAGG - Intergenic
1186402591 X:9273577-9273599 AAAAGGAAGAAGGAGGAAGAAGG + Intergenic
1186425411 X:9460956-9460978 CAGGGGTTCAAGGAGGAAGAAGG - Intergenic
1186540281 X:10393304-10393326 GAGAGGAGAAAGGTGGAAGATGG - Intergenic
1186603924 X:11069005-11069027 CAGTGGAAAAAAAAAGAAGAAGG + Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186899998 X:14043836-14043858 CAGGGGAGAAAGGAAGGAGAGGG + Intergenic
1186962497 X:14751703-14751725 AAAGGGTAAAAGGAGCAAGAAGG + Intergenic
1187046592 X:15653494-15653516 GAGGAAAAAGAGGAGGAAGAAGG - Intronic
1187110053 X:16288783-16288805 GAGGGAAAGAGGGAGGAAGAGGG - Intergenic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187247708 X:17567804-17567826 GAGGGGAGGAGGGAGGAAGAAGG + Intronic
1187396878 X:18927013-18927035 CGGGGGAAAGAAGAGTAAGATGG + Intronic
1187551331 X:20308877-20308899 GAGGAGGAAAAGGATGAAGATGG - Intergenic
1188680182 X:32994197-32994219 CAGAGGAAAATGGTGGCAGAAGG + Intronic
1188904846 X:35779470-35779492 CAAAGGGAAAAGGAGGAATAGGG + Intergenic
1189042089 X:37553569-37553591 AAAGGGAAAAAGGGGGAAGAGGG + Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189110706 X:38286414-38286436 GAAGGGAAAGGGGAGGAAGAAGG - Exonic
1189135663 X:38546876-38546898 TAGAGGAAAGAGGAGGAAAAGGG + Intronic
1189514942 X:41704028-41704050 TAGGGGAAAAGGGAGGGGGAGGG - Intronic
1189778064 X:44487873-44487895 GGGGGGAAAAAGGAAGAAAAAGG + Intergenic
1189939986 X:46111832-46111854 TAAGGGAAAAATGAGGAAGATGG + Intergenic
1190737069 X:53262600-53262622 CAGGGGAGAGAGGAGGCAGGGGG + Intronic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1191595727 X:62942156-62942178 AAGGGGAAGAAGGAGTAAGGTGG - Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191890198 X:65931906-65931928 GAGGGGGAAAAGGAGGAAAGAGG - Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192196691 X:69033508-69033530 TAGGGGAAAAAGAAGCAAAAAGG + Intergenic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1193503422 X:82309285-82309307 CAAGAGAAAAATGAGGAAGAAGG + Intergenic
1193535303 X:82708040-82708062 CAGAGGAGAAAGCTGGAAGATGG + Intergenic
1193656678 X:84206748-84206770 CAGGAGAAAATAAAGGAAGAGGG - Intergenic
1194411282 X:93561746-93561768 GAGTGGGAAAAAGAGGAAGAAGG - Intergenic
1194721567 X:97346431-97346453 CTGGCAAGAAAGGAGGAAGACGG - Intronic
1194847734 X:98832528-98832550 AAGAAGAAAAAGGAGGAAGGAGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195069655 X:101266930-101266952 CAAGGGAAAAAGTAGGACTAAGG - Intergenic
1195229384 X:102830778-102830800 GAGGGGAAAAAGGTGCAAAAGGG - Intergenic
1195994044 X:110713516-110713538 CAGGGGAGTAAAGGGGAAGACGG - Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196130134 X:112146590-112146612 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196130138 X:112146609-112146631 CAGGGAAATGAGGAGGAAGCAGG + Intergenic
1196392785 X:115226123-115226145 CAAGAGAAAAAGGAGGAGGGGGG + Intronic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1196731085 X:118942220-118942242 AAAGGGAAGAAGGAGGAAGGAGG + Intergenic
1196765432 X:119237476-119237498 AAGGTGAACAAGGAGGAAGGGGG + Intronic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1196865202 X:120065075-120065097 CAGGGGGCAGAGGAGGAAGCAGG + Intergenic
1196877891 X:120171205-120171227 CAGGGGGCAGAGGAGGAAGCAGG - Intergenic
1197107899 X:122737619-122737641 AAAGGGAAAAAGGAGGATCAAGG + Intergenic
1197308281 X:124871132-124871154 AAGGGGGAAAAGGGAGAAGATGG - Intronic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197795216 X:130291075-130291097 TTGGGGAAGAAAGAGGAAGATGG - Intergenic
1197889951 X:131259630-131259652 CTGGGGAACAAGGAGTGAGAGGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198706156 X:139450693-139450715 CAGGGGACAGGGGCGGAAGATGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199460062 X:148074587-148074609 CAGAGGAAAAGGGAAGAAGTGGG + Intergenic
1199609993 X:149604931-149604953 GAGGGGGAAAAGGAGACAGAAGG - Intronic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1200374707 X:155767564-155767586 GAGGAGGTAAAGGAGGAAGAAGG + Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201458994 Y:14201593-14201615 GGAGGGAAAAAAGAGGAAGAGGG + Intergenic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic
1201537730 Y:15069085-15069107 CAGGGGAGAAACCAGCAAGATGG + Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1201683364 Y:16673477-16673499 CAGAGGAAGAAAGAGAAAGAAGG + Intergenic
1201701079 Y:16882896-16882918 GAGGGAAAAAAGGAGAAGGAAGG + Intergenic
1202376919 Y:24246373-24246395 GAAGGGAAAGGGGAGGAAGATGG - Intergenic
1202493861 Y:25423748-25423770 GAAGGGAAAGGGGAGGAAGATGG + Intergenic