ID: 995447775

View in Genome Browser
Species Human (GRCh38)
Location 5:112265570-112265592
Sequence ATGTCATAGATGAAGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995447775_995447780 30 Left 995447775 5:112265570-112265592 CCAACCCACTTCATCTATGACAT 0: 1
1: 1
2: 0
3: 13
4: 189
Right 995447780 5:112265623-112265645 TTAGTCTGCAAGTGCCACAAGGG 0: 1
1: 0
2: 3
3: 8
4: 141
995447775_995447779 29 Left 995447775 5:112265570-112265592 CCAACCCACTTCATCTATGACAT 0: 1
1: 1
2: 0
3: 13
4: 189
Right 995447779 5:112265622-112265644 TTTAGTCTGCAAGTGCCACAAGG 0: 1
1: 2
2: 4
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995447775 Original CRISPR ATGTCATAGATGAAGTGGGT TGG (reversed) Intronic
906843913 1:49169439-49169461 ATGACATGGATGATCTGGGTTGG - Intronic
913310624 1:117488102-117488124 ATGTCAAACATTAAGTGGCTGGG - Intronic
914699815 1:150121903-150121925 ATGTAATAGATGCAGTGGGGGGG + Intronic
916646593 1:166792686-166792708 ATGACATAGAGGAAGGGGCTTGG - Intergenic
916845402 1:168645101-168645123 ATGTCCTAGATCAAGAGGGTCGG + Intergenic
921782951 1:219190160-219190182 ATATCATACATGCAGTGGGCGGG - Intronic
923911581 1:238452244-238452266 TTTTCATAGAAGAAGTAGGTTGG + Intergenic
924418460 1:243883944-243883966 ATGTCATGGGTGCAGTGTGTAGG - Intergenic
924852596 1:247845283-247845305 ATGCCACAGATGAAGAGGATCGG - Intergenic
1064190727 10:13203395-13203417 TTGTCCTAGATGATCTGGGTGGG - Intronic
1064319535 10:14290789-14290811 ATTTTATAGATGAAGAGAGTGGG - Intronic
1066214852 10:33276332-33276354 ATCTCATTGATCCAGTGGGTGGG - Intronic
1067215170 10:44295239-44295261 ATATCATATGTGATGTGGGTGGG - Intergenic
1068407958 10:56617119-56617141 ATTTAAAAGATGAACTGGGTGGG - Intergenic
1070537944 10:77393341-77393363 ATGTCATGGAGGAAATGGGCTGG - Intronic
1073247613 10:102102670-102102692 AGGTCATAGATGAAATGGATGGG - Intergenic
1074678930 10:115883260-115883282 AGGTCTTAGATGGAGTGGGAAGG - Intronic
1077687138 11:4304274-4304296 AAGTCATAGATTGATTGGGTTGG + Intergenic
1077744933 11:4891847-4891869 ATGTCACAGATGAAGTGGGTTGG + Intronic
1080921873 11:36717187-36717209 ATGTCTTAGAAGGAGTCGGTTGG - Intergenic
1083399056 11:62411447-62411469 AAGTCATAGAAGGAGTGGGGTGG - Intronic
1084043785 11:66557529-66557551 AAGTCAGAGAAGAAGTGGGATGG - Intronic
1085322334 11:75582988-75583010 ATGGTCTAGAGGAAGTGGGTGGG - Intergenic
1085417670 11:76330107-76330129 ATGACAAGGATGAAGTGGGGAGG - Intergenic
1085943248 11:81231918-81231940 AAGTTATAGAGGAAGTGGGTTGG - Intergenic
1087218686 11:95522353-95522375 ACGTGATAGGTGAAGTTGGTGGG - Intergenic
1087679712 11:101206104-101206126 ATGTAAGATATGAAATGGGTGGG - Intergenic
1090471480 11:126984925-126984947 AAGTCATACAGGTAGTGGGTGGG - Intronic
1092955298 12:13543938-13543960 ATGTCTTTGATGAAGTGAGAGGG - Exonic
1096882651 12:54685352-54685374 AGGTCATAGAAAAAGTGGGCTGG - Intergenic
1098467113 12:70800233-70800255 ATGTCTAAAATGCAGTGGGTAGG - Intronic
1100217560 12:92468099-92468121 ATCTCTTAAGTGAAGTGGGTAGG + Intergenic
1102092613 12:110204748-110204770 ATGTGATAGAGGGACTGGGTGGG - Intronic
1102404091 12:112657778-112657800 ATGAAATAGGGGAAGTGGGTAGG + Intronic
1103846052 12:123902676-123902698 TTGTCCTGGATGGAGTGGGTGGG + Intronic
1107657124 13:42603218-42603240 ATATCTTAGATGAAATGCGTTGG + Intronic
1108955011 13:56142420-56142442 ATGTAATAGAGTAAGTGGGGAGG - Intergenic
1109250827 13:60018670-60018692 TTGTAATAGATGAAGTGATTTGG - Intronic
1109594401 13:64530894-64530916 AACTCAGAGATCAAGTGGGTAGG - Intergenic
1110155541 13:72312346-72312368 ATGTAATAGTGGGAGTGGGTGGG + Intergenic
1110735957 13:78936841-78936863 ATGGAAAAGATGAAGTGGGTAGG - Intergenic
1110775437 13:79404004-79404026 ATTTCATAGAAAAAGTGTGTAGG - Intronic
1111096854 13:83527556-83527578 ATTTAATAGATGTAGTGGGCCGG + Intergenic
1111831196 13:93331898-93331920 ATGTCATAGAGGTAGAGAGTAGG - Intronic
1114189361 14:20429197-20429219 ATGTCATGGCTGCATTGGGTGGG - Exonic
1120393272 14:83935456-83935478 AAGTCATGGATGAAGTGTCTTGG + Intergenic
1120500522 14:85291601-85291623 ATTTCAGAGATGAGGAGGGTAGG - Intergenic
1122354111 14:101113067-101113089 TTGACAGAGATGAGGTGGGTGGG + Intergenic
1123175017 14:106408739-106408761 TTGTCATTGATAAAATGGGTGGG + Intergenic
1123215907 14:106809312-106809334 TTGTCCTAGATGAACTTGGTCGG + Intergenic
1124075493 15:26440086-26440108 ATCTCATAGAGGCAGAGGGTAGG - Intergenic
1124490194 15:30150756-30150778 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1124753338 15:32387573-32387595 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1124975081 15:34523273-34523295 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1128845917 15:70894242-70894264 ATGTCATAGTTTAATTGGGGAGG + Intronic
1129210504 15:74065318-74065340 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1129403507 15:75300056-75300078 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1129727705 15:77909953-77909975 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1129840190 15:78739022-78739044 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1130282594 15:82531540-82531562 AAGTCACAGATGAAGAGGGCTGG + Intergenic
1130473916 15:84247351-84247373 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1130481330 15:84361419-84361441 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1131845693 15:96488393-96488415 ATGTCAAAAGTGGAGTGGGTTGG + Intergenic
1131997424 15:98145715-98145737 AAGCAATAGAGGAAGTGGGTGGG + Intergenic
1133576220 16:7093406-7093428 GTGTCAAAGAAGAAGTGGGCTGG - Intronic
1134365305 16:13571634-13571656 ATAAAATTGATGAAGTGGGTTGG - Intergenic
1134446257 16:14333536-14333558 ATGTCATGGAAGAAAAGGGTAGG - Intergenic
1136873472 16:33828768-33828790 TTGTCCTAGATGAACTTGGTCGG - Intergenic
1137895467 16:52207037-52207059 ATGTCACACAGGAAGTTGGTAGG + Intergenic
1141129371 16:81424943-81424965 ATGTCAAACAGGAAGTGGGCAGG + Intergenic
1203098703 16_KI270728v1_random:1287287-1287309 TTGTCCTAGATGAACTTGGTCGG + Intergenic
1143178343 17:4969101-4969123 ATGGCGTGGATGCAGTGGGTGGG + Intronic
1143218512 17:5242349-5242371 ATGTGATTGATAAAGAGGGTGGG - Intergenic
1144528124 17:16008615-16008637 ATGGCATGGAAGAGGTGGGTGGG - Intronic
1146004255 17:29150886-29150908 TTGTCAAACATGAAGTTGGTTGG + Intronic
1147148620 17:38500059-38500081 AGGGCAAAAATGAAGTGGGTGGG - Intronic
1149239754 17:54635411-54635433 ATGTCATCCATGAACTAGGTAGG - Intergenic
1149279888 17:55091621-55091643 ATATCAAAGCTGAAGTGGGCTGG - Intronic
1149768569 17:59301267-59301289 ATGTGAAAAATGAAATGGGTAGG + Intergenic
1149952163 17:61000132-61000154 AAGTCATAGCTGAAGTGATTAGG - Intronic
1149970091 17:61209427-61209449 ATGTCAAAGATCAAGTAGATTGG + Intronic
1150000505 17:61434130-61434152 ATGTCACAGCTGAAGGGGGATGG + Intergenic
1156609624 18:38711239-38711261 ATGTCACAGATGATGTGGGATGG + Intergenic
1156810721 18:41246947-41246969 CTTTCATAAATGATGTGGGTTGG - Intergenic
1156969456 18:43137444-43137466 ATGTCATGGATGAACATGGTGGG + Intergenic
1157096231 18:44687771-44687793 ATGTCATGGATCTAGTGGGCTGG + Intronic
1157164718 18:45347922-45347944 TGGACATAGATAAAGTGGGTTGG - Intronic
1157391513 18:47307274-47307296 GTGTCATAGATGGAGTGGTGTGG - Intergenic
1159485844 18:69056116-69056138 ATGTGATAGATTAAGTGGACAGG + Intergenic
1159893460 18:73974368-73974390 ATGTCAGAGTTGCAGTGGGTGGG + Intergenic
1162354710 19:10175159-10175181 ATGTCATAGCTCAAGTGGCAAGG - Intronic
1162955231 19:14093761-14093783 AAGTCAGAGCTGAAGTGGGAAGG + Exonic
926420607 2:12693014-12693036 ATGGCCTTGATAAAGTGGGTGGG - Intergenic
932286208 2:70534224-70534246 ATGTCATCGCTAAAGTTGGTGGG + Intronic
933507332 2:83194674-83194696 AAGTTATAAATGAAGTGGATGGG + Intergenic
936890945 2:117369222-117369244 ATGTCATAGATGGTCTGCGTAGG + Intergenic
937801386 2:126084472-126084494 ATGACACAGATGAAGTGAGAGGG + Intergenic
939833115 2:147096258-147096280 ATGTGATAGATGAACTGTGATGG - Intergenic
941516175 2:166481943-166481965 CTGTCAAAAATGAAATGGGTTGG + Intronic
942312122 2:174665867-174665889 ATGACAGACATGAAGTGGGACGG - Intronic
944202875 2:197126634-197126656 AAGTCATAGATCAAGAGGTTAGG - Intronic
945652418 2:212580057-212580079 ATGTTATAGATGAAGATGGATGG - Intergenic
946511226 2:220358698-220358720 ATGACATACATGAAATGGATGGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948689492 2:239692928-239692950 AGGTCATAGCTAAAGGGGGTGGG - Intergenic
1172034891 20:32003610-32003632 ATTTTACAGATAAAGTGGGTGGG + Intergenic
1172650043 20:36496388-36496410 ATGTACTAGGTGAAGTGCGTGGG - Intronic
1173758380 20:45538312-45538334 ATCTCATAGATGGTGCGGGTAGG - Intronic
1174893192 20:54420354-54420376 ATTTCATACATGCCGTGGGTTGG + Intergenic
1175132052 20:56796648-56796670 AAGCCAGAGATGAGGTGGGTGGG - Intergenic
1177774927 21:25557297-25557319 ATTTCAGAGAGGAAGGGGGTGGG + Intergenic
1178047096 21:28707764-28707786 ATGTCAATAATGAATTGGGTGGG + Intergenic
1178827591 21:36029648-36029670 ATGTCACAGAGGAAGCAGGTTGG - Intergenic
1179349741 21:40597077-40597099 ATGTGATAAATTAATTGGGTTGG - Intronic
1183594397 22:38801661-38801683 ATTTTATAGATGAAGAGGGTTGG - Intergenic
1184175730 22:42787826-42787848 AAGTCACAGATGAAGGGGGCTGG + Intergenic
951265210 3:20557328-20557350 ATGTAAGAGATGAAGTCGATAGG + Intergenic
951591889 3:24275346-24275368 ATTTAATAGATGAAGAAGGTGGG - Intronic
951652596 3:24967475-24967497 CTGTCAGAGATGAAGAGGGAAGG - Intergenic
952579507 3:34815789-34815811 ATTTCATATATGATGTGGTTTGG + Intergenic
954015868 3:47690342-47690364 ATATTAGAGAGGAAGTGGGTAGG + Intronic
954171831 3:48809944-48809966 ATTTAAGAGATGAAGTGGGAGGG - Intronic
955184279 3:56700253-56700275 ATGTCAGAGATGAAGAGGAAGGG + Intergenic
958616534 3:96500172-96500194 ATATCACAGATGAACTGGGGCGG - Intergenic
959062877 3:101632140-101632162 AAGTCCTTGAGGAAGTGGGTGGG - Intergenic
959064331 3:101641604-101641626 AAGTCCTTGAGGAAGTGGGTGGG - Intergenic
959159606 3:102707332-102707354 ATATCACAGATGAAGAGGGCTGG + Intergenic
961479140 3:127168321-127168343 CTGTCATGAATGAAGTGGGGTGG + Intergenic
962478386 3:135777893-135777915 ACGTCACAGCTGAAGTGGGAAGG - Intergenic
970355252 4:15245012-15245034 ATGGGATAAATGAAGTGGGGAGG - Intergenic
970411532 4:15813053-15813075 ATGTCATCCATGAAGGGGATAGG + Intronic
971588733 4:28439391-28439413 ATGTCATATTTTAAGTTGGTTGG - Intergenic
972986849 4:44775170-44775192 ATGTCATAGATGTTCTGTGTAGG + Intergenic
974009925 4:56597373-56597395 ATGTCAAGGATGAAGAGGGAGGG - Intronic
974088139 4:57282751-57282773 ATGTCTGAGATGAACTGGGCCGG - Intergenic
977951902 4:102980768-102980790 TGGTCATAGAGGAAGTGTGTGGG - Intronic
978295976 4:107205671-107205693 AGGACAGAGATGAAGTGGATGGG - Intronic
979311414 4:119208564-119208586 AAGGCACAGATGAAGTGGGAAGG - Intronic
983500815 4:168497391-168497413 AAGGCAGAGATGAAGTGGGCAGG - Intronic
983983746 4:174032037-174032059 ATGTCATAAATGCTATGGGTGGG + Intergenic
986778223 5:11039183-11039205 ATGTCAGAGATGATGTTGATTGG - Intronic
990114869 5:52377396-52377418 ATGTCATGGAAGATGAGGGTAGG + Intergenic
990305927 5:54493940-54493962 AGGATATAGATGAAGTGTGTAGG - Intergenic
991555291 5:67888967-67888989 ATTTCTTAGATAAATTGGGTGGG + Intergenic
992708081 5:79418133-79418155 ATTTAATAAATGAAGTTGGTAGG - Intronic
993386173 5:87266285-87266307 ATGTCATTCATTAGGTGGGTAGG - Intergenic
993802076 5:92354456-92354478 GTCTCATAGAAGAAGTGGTTAGG + Intergenic
995447775 5:112265570-112265592 ATGTCATAGATGAAGTGGGTTGG - Intronic
997238620 5:132291019-132291041 ATGGGATAGAAGAAGTTGGTGGG - Intronic
998440747 5:142160021-142160043 ATGTCACCAAAGAAGTGGGTTGG - Intergenic
1001061375 5:168492462-168492484 ATGTCTTAGATGCCGTGGGATGG + Intronic
1001845668 5:174918491-174918513 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1003904048 6:10682511-10682533 AAGTCATAAAGGCAGTGGGTGGG + Intronic
1003992381 6:11498871-11498893 ATGTCATTGATGCAGTGGATGGG + Intergenic
1005715999 6:28549250-28549272 ATGTCAGAATTGAACTGGGTTGG - Intergenic
1005771592 6:29078550-29078572 ATGTCAATAATGAATTGGGTGGG - Intergenic
1006928186 6:37670713-37670735 CTGTCACAGATGATGAGGGTTGG + Intronic
1007005344 6:38357219-38357241 CTGTGATGAATGAAGTGGGTAGG - Intronic
1008860110 6:56138831-56138853 ATGTGGTAGAGGAAGTGGGGAGG + Intronic
1009911427 6:69934202-69934224 ATGAGATACATGAAGTGGATTGG - Intronic
1010383468 6:75250459-75250481 ATGCTAAAGATGAAGTGGGAAGG + Intergenic
1010970445 6:82257370-82257392 GTGTTATAAATGTAGTGGGTTGG + Intergenic
1011879001 6:91999573-91999595 ATATCACAGCTGAAGGGGGTTGG - Intergenic
1011979322 6:93352785-93352807 GTGACATGGATGAAGTGGGTGGG + Intronic
1012087514 6:94849087-94849109 ATGTATTAGATGCAGTTGGTAGG + Intergenic
1012938788 6:105395992-105396014 ATGGCAGGGATGAAGTGGGGAGG + Intronic
1014179291 6:118367228-118367250 ATGTAACAGCTGAAGTGGATTGG + Intergenic
1014676459 6:124373218-124373240 ATGTCATGGATGCAGGGTGTAGG + Intronic
1016286655 6:142481260-142481282 AAGTCCTAAATGAAGTGGTTTGG + Intergenic
1017728879 6:157296741-157296763 ATGTCTTAGATGAGGATGGTGGG - Intronic
1018772259 6:166981533-166981555 ATGGCAAATATTAAGTGGGTGGG - Intergenic
1021851267 7:24810725-24810747 ATCTCATAGAAGCAGAGGGTGGG - Intronic
1022356180 7:29616730-29616752 ATGTCAAAGATGAAGTTGCCTGG + Intergenic
1023675248 7:42621980-42622002 TTTTCATAGGTGGAGTGGGTGGG - Intergenic
1024105312 7:46078544-46078566 ATGTTATATTTGAAGTGAGTTGG - Intergenic
1025227385 7:57177420-57177442 ATGTCATCGATGTAGGTGGTGGG + Intergenic
1025730485 7:64102871-64102893 ATGTCATCGATGTAGGTGGTAGG - Intronic
1025928793 7:65979431-65979453 ATGTCATCGATGTAGGTGGTGGG + Exonic
1028370254 7:90083937-90083959 TTGTCATAGATGAAGTAATTGGG - Intergenic
1031755620 7:125638152-125638174 ATGACAGAGATTAAGTGGTTTGG + Intergenic
1033051253 7:138006366-138006388 ATGTCAGAGATGAAATGGGCAGG - Intronic
1036146939 8:6262617-6262639 ATGTCAAAGCTGATGTGGGGCGG - Intergenic
1037384711 8:18326179-18326201 ATGTCCTAGCTCAAGTGGGAAGG + Intergenic
1039411614 8:37359833-37359855 AGCTCATAAATGAAGTGGATTGG - Intergenic
1039508743 8:38071945-38071967 AAGTCATTGAGGAAGGGGGTGGG + Intergenic
1044810941 8:96061293-96061315 AGGTCATAGAGGTAGTGGGTAGG - Intergenic
1045093762 8:98775351-98775373 ATGTCAGAGCTGAAGGGGGCTGG - Intronic
1046454083 8:114436469-114436491 ATGTGAAGCATGAAGTGGGTTGG - Intergenic
1047049766 8:121097842-121097864 AAGTAATAAATGAAGTAGGTTGG + Intergenic
1048722423 8:137341293-137341315 TTGTCACAGAAGAAGTGGTTGGG + Intergenic
1048863508 8:138741384-138741406 ATATCATAGAGGAAAGGGGTTGG - Intronic
1049455046 8:142682455-142682477 AAGTCATAGATGGGGTGGGCAGG - Exonic
1051793546 9:20836800-20836822 AAGTCATATATGAAACGGGTAGG + Intronic
1051898355 9:22011834-22011856 ATTTAAAAGATGAAGTGGATGGG + Intronic
1059800271 9:117743115-117743137 ATGACATAGAAGGAGTGGGTGGG + Intergenic
1061061937 9:128254805-128254827 AAGTCACAGATGAAGGGGGCTGG - Exonic
1186398449 X:9234259-9234281 ATGTAATGGATGAAGAGGATGGG - Intergenic
1187518936 X:19996731-19996753 ATGTAATAGGTGTAGTGGCTTGG + Intergenic
1187664533 X:21590673-21590695 AGGGCATGGATGAAGTGTGTTGG - Intronic
1195409854 X:104558090-104558112 ATAACACAAATGAAGTGGGTAGG + Intergenic
1202367850 Y:24179203-24179225 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1202376990 Y:24246705-24246727 AAGTCACAGATGAAGGGGGCTGG - Intergenic
1202493790 Y:25423416-25423438 AAGTCACAGATGAAGGGGGCTGG + Intergenic
1202502933 Y:25490914-25490936 AAGTCACAGATGAAGGGGGCTGG - Intergenic