ID: 995448202

View in Genome Browser
Species Human (GRCh38)
Location 5:112270240-112270262
Sequence CTGAGAAAACTGAAGGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995448197_995448202 11 Left 995448197 5:112270206-112270228 CCTGCAGTGCACCTTCTAATGAC 0: 1
1: 0
2: 0
3: 7
4: 79
Right 995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG 0: 1
1: 1
2: 1
3: 33
4: 421
995448198_995448202 0 Left 995448198 5:112270217-112270239 CCTTCTAATGACTTAAGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 82
Right 995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG 0: 1
1: 1
2: 1
3: 33
4: 421
995448196_995448202 20 Left 995448196 5:112270197-112270219 CCAAAGAATCCTGCAGTGCACCT 0: 1
1: 0
2: 0
3: 3
4: 106
Right 995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG 0: 1
1: 1
2: 1
3: 33
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995448202 Original CRISPR CTGAGAAAACTGAAGGATGT AGG Intronic
900750116 1:4390357-4390379 CTGAGAAAACTGACTTAGGTGGG - Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
904466242 1:30709344-30709366 ATGAGGAAACTGAAGCATGGAGG - Intergenic
904796700 1:33061707-33061729 CTCAGAAAGCTGAAGCAAGTTGG + Intronic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
906754844 1:48301578-48301600 CTGAGCAAACAGAACGAAGTTGG + Intronic
907322717 1:53615582-53615604 CTGAGAAGTTTAAAGGATGTTGG - Intronic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
907993709 1:59608216-59608238 TGGGGAAAACTGAAGGATTTGGG - Intronic
908107838 1:60863939-60863961 CGGAGAAAACTGTAGGTTCTTGG + Intergenic
909580031 1:77223121-77223143 CTCAGAAGACAGAAAGATGTAGG - Intergenic
909675484 1:78234923-78234945 CTGAGCAGACTGAAGCATGGGGG - Intergenic
910417258 1:87014025-87014047 CTCAGAAGACAGAAAGATGTGGG - Intronic
911117476 1:94260729-94260751 CAAAGAAAAATGAAGGAAGTTGG + Intronic
912147455 1:106810622-106810644 CTCAGAAGACAGGAGGATGTGGG - Intergenic
912850299 1:113118274-113118296 CTTTGAAAACTGAATGATGAAGG - Intronic
913651738 1:120920958-120920980 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914169368 1:145208107-145208129 CTAAGCAAACAGAAGCATGTAGG + Intergenic
914452454 1:147804748-147804770 ATGAGAAAACTGAGGCATGGAGG - Intergenic
914524485 1:148452071-148452093 CTAAGCAAACAGAAGCATGTAGG + Intergenic
914599183 1:149183759-149183781 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914641917 1:149615069-149615091 CTAAGCAAACAGAAGCATGTAGG - Intergenic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
916965703 1:169940223-169940245 TTAAGAAAACTGAAGCATGTAGG - Intronic
917962429 1:180155312-180155334 CTGAGAAACATGAAGGTGGTGGG - Intronic
918090353 1:181287941-181287963 CTGAGAAAACTGAAATAAATGGG - Intergenic
919656024 1:200197964-200197986 CTGTGAAAAATGCAGAATGTTGG - Intergenic
919965537 1:202520091-202520113 CTGAGCAAGCTGAAGAATGGAGG + Intronic
920380029 1:205529803-205529825 CTGAGGAAACTGAGGCATGGAGG - Intronic
920540728 1:206776042-206776064 CTGGGAAATCAGAAGGTTGTGGG + Intergenic
920779688 1:208976600-208976622 CTGACAAAACTCAAGGCTGGGGG - Intergenic
921097120 1:211896122-211896144 ATGAGAAAACTGAGGCATGGAGG - Intergenic
921375982 1:214474305-214474327 CTGAGCAAAGTGTATGATGTTGG - Intronic
921531162 1:216284725-216284747 CTCAGAAGACAGAAAGATGTGGG + Intronic
922667923 1:227488602-227488624 CTTAGAAAACAGGAAGATGTTGG - Intergenic
924087380 1:240466838-240466860 CTGTGAACAATGAAGTATGTGGG + Intronic
1062931731 10:1357340-1357362 CTGAGAAAAATGAGGGAGGTTGG + Intronic
1063670425 10:8095570-8095592 CGGAGATGACTGAAGGATGGTGG + Intergenic
1065208328 10:23378350-23378372 ATGAGGAAACTGAAGCATGCAGG + Intergenic
1065469773 10:26065730-26065752 CAGAGAAAATTCAATGATGTAGG + Intronic
1067353521 10:45500939-45500961 CTAAAAAAACTGAAGTATTTAGG + Intronic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069178137 10:65320816-65320838 ATGTGAAAACTGAAGGGTGATGG - Intergenic
1071797190 10:89019382-89019404 CTCAGAGAACTAAAGGGTGTGGG - Intergenic
1072162992 10:92785432-92785454 TTTAGAAAACCCAAGGATGTGGG + Intergenic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073839644 10:107483649-107483671 CTGAGAAGACTCAAAGATCTGGG + Intergenic
1073864507 10:107786613-107786635 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1074331275 10:112512178-112512200 CTGAGAAAAGTGAACAGTGTTGG - Intronic
1079118343 11:17655369-17655391 CTGAGGCAACTGAAATATGTGGG + Intergenic
1079346556 11:19657558-19657580 TTCAGAAAGCTGAAGGAAGTGGG - Intronic
1080119572 11:28661641-28661663 CTGAGAAGACTGAGGCAAGTGGG + Intergenic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080625658 11:34028471-34028493 CTAAGGAAACTGAAGGTTCTGGG + Intergenic
1080979763 11:37387387-37387409 TAGAGAAAACTGATGGATCTGGG - Intergenic
1081146757 11:39570352-39570374 CTAATAAAACTGAAGGCTGCAGG + Intergenic
1081481667 11:43495490-43495512 CTGATAAAACTGGAGTTTGTTGG - Intergenic
1081981872 11:47271879-47271901 ATGAGCAAACTGCAGGAGGTGGG - Intronic
1084800630 11:71541397-71541419 CTGAGAAAAATGCAAGATGCAGG + Intronic
1084884075 11:72192025-72192047 CTGGGAAAACTGAGGGAGATGGG + Intronic
1085973135 11:81618261-81618283 CTGAGAAAGGTAAAGGATGCAGG + Intergenic
1086093588 11:83028436-83028458 TTCAGAGAACTGAAGGATGCAGG + Intronic
1087596068 11:100256768-100256790 CTGAGAAAAGTGTAGTATCTGGG - Intronic
1087966239 11:104419643-104419665 ATGAGAAAACTGAACGATCAAGG + Intergenic
1090824580 11:130375380-130375402 CTGAGAACTCTAAAGGATGGGGG - Intergenic
1091276863 11:134358649-134358671 GTGAGAGAAGGGAAGGATGTAGG + Intronic
1091811942 12:3406765-3406787 CTCAGAAGACAGAAAGATGTAGG - Intronic
1092197251 12:6556716-6556738 CTGGGAAAACCCAAGGATGCAGG + Intergenic
1094421257 12:30273503-30273525 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1095538889 12:43285318-43285340 CTGAGAAACAAGAAGGAGGTTGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098568907 12:71967320-71967342 TTGAGAATATTGAAGGCTGTGGG - Intronic
1098675029 12:73279273-73279295 CTGGGAAAAAAGAAAGATGTTGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099448455 12:82779291-82779313 TGGAGAGAACTGAAGGATTTAGG + Intronic
1099637697 12:85235628-85235650 CTGAGAAAACTGCAGCCTGAGGG - Intronic
1101033934 12:100686278-100686300 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101193127 12:102355220-102355242 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1101194738 12:102370609-102370631 CTAAGAAAACAGGAAGATGTGGG - Intergenic
1102436535 12:112928743-112928765 CTGAGCAAACTCAAGGACTTGGG + Intronic
1103205619 12:119126406-119126428 ATGAGAAAACTGAGGCATGGGGG + Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1103966942 12:124646086-124646108 CTGAGCACAGTGCAGGATGTGGG + Intergenic
1104224195 12:126815119-126815141 CTGAGAAAGCTGCAGGCTGCAGG - Intergenic
1106517530 13:30468050-30468072 CTGAGAGAATTGAAGCATGGAGG - Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1107051833 13:36058883-36058905 CTGAGAAAAATAAGGGATATTGG - Intronic
1107108449 13:36671893-36671915 CTCTGACAACTGCAGGATGTTGG + Intergenic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1107612613 13:42131381-42131403 CTGAGTAAGCTGACGGGTGTAGG + Intronic
1107617293 13:42182844-42182866 CTGAGAAAACTAAGGGAAATGGG - Intronic
1108093425 13:46875550-46875572 CTGAGAAACATGAAGTATGGTGG - Intronic
1108100133 13:46945629-46945651 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1108233593 13:48376948-48376970 CTGAAAAGAGTGAAGGATATAGG + Exonic
1109416769 13:62051009-62051031 CTCAGAAGACTGGAAGATGTGGG + Intergenic
1109789505 13:67228908-67228930 CTGAAAAGACTGAGGGAGGTAGG - Intronic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1111307438 13:86433911-86433933 CTCAGAAGACAGGAGGATGTGGG + Intergenic
1111385376 13:87520726-87520748 CTGAGAAGACAGAAAGATGTGGG + Intergenic
1111534758 13:89588847-89588869 TGGAGAAAACTGGAAGATGTAGG + Intergenic
1112857342 13:103787479-103787501 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1112859005 13:103807729-103807751 CTCAGAAAACAGGAAGATGTGGG + Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115374942 14:32664435-32664457 TAGAGAAAACTGAAGAATATTGG + Intronic
1115394752 14:32895562-32895584 CTTAGAAAACTGGAGTATTTGGG - Intergenic
1116286984 14:42986485-42986507 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1116350375 14:43854783-43854805 CTGAGAAAAAGGAAACATGTAGG - Intergenic
1118456178 14:65947306-65947328 ATGAAAAAACTGAAGGACGTTGG + Intergenic
1119332533 14:73805653-73805675 ATGAGAAAACTGAAGGACAGAGG + Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120357965 14:83458538-83458560 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1122071896 14:99210384-99210406 CTGAGAAAGCCCAGGGATGTAGG - Intronic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1202844211 14_GL000009v2_random:152217-152239 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
1202913604 14_GL000194v1_random:142460-142482 CTGGGAAAGCTGATGGCTGTGGG - Intergenic
1202879053 14_KI270722v1_random:40231-40253 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
1123463075 15:20492444-20492466 CTACAAAAACTGAAGGATGCTGG - Intergenic
1123628779 15:22246321-22246343 CTCAGAAAACAGGAGGATGTGGG + Intergenic
1123654986 15:22507970-22507992 CTACAAAAACTGAAGGATGCTGG + Intergenic
1124225983 15:27895385-27895407 CTCAGAATACAGAAGAATGTGGG + Intronic
1124273917 15:28309847-28309869 CTACAAAAACTGAAGGATGCTGG - Intronic
1124308894 15:28603171-28603193 CTACAAAAACTGAAGGATGCTGG + Intergenic
1124413008 15:29452198-29452220 CTGAGAAAGCAGATGGTTGTGGG - Intronic
1125516042 15:40321996-40322018 CTGAGAAATTTCAAGGATATTGG - Intergenic
1126002502 15:44224266-44224288 CTGAAAAAAGTCAAGGTTGTGGG - Intergenic
1129698742 15:77755386-77755408 ATGAGGAAACTGAAGCATGGAGG + Intronic
1131927325 15:97400006-97400028 CTGAGGAAATGGAAAGATGTTGG - Intergenic
1132656081 16:1042487-1042509 CTGAGAAAACCACACGATGTAGG + Intergenic
1134138875 16:11699357-11699379 ATGCTAAAAATGAAGGATGTAGG + Intronic
1135876602 16:26206316-26206338 CTCTGATAACTGGAGGATGTGGG - Intergenic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1140203078 16:72910452-72910474 TTGAGAAAAATGAAGTATTTAGG + Intronic
1141031785 16:80595562-80595584 CTGATATATCTGATGGATGTGGG + Intergenic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1141975302 16:87511948-87511970 CTCAGAAGACAGGAGGATGTGGG - Intergenic
1143175237 17:4951345-4951367 CTGGGAACACCGAAGGATCTAGG + Intronic
1143959910 17:10708090-10708112 CTGAGAACACTGCAGTTTGTAGG - Intronic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144479393 17:15616502-15616524 CTAAGAAAAGAGAAGGTTGTTGG + Intronic
1144529042 17:16018402-16018424 ATGAGAAAACTGATGGAAGAGGG - Intronic
1144918911 17:18747224-18747246 CTAAGAAAAGAGAAGGTTGTTGG - Intronic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1148330385 17:46810581-46810603 ATGAGAAAACTGAGGGAGGGAGG + Intronic
1150606015 17:66691654-66691676 CTGAGACAGCTGAAGAATGCTGG - Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1153010133 18:531185-531207 TTGAGCAAACCGAAGGCTGTAGG + Intergenic
1153177750 18:2398137-2398159 ATGAGAAAAATCAAGCATGTGGG + Intergenic
1153767895 18:8391994-8392016 ATGAGAAAAATCTAGGATGTGGG + Intronic
1154330922 18:13428501-13428523 CTGAGTAAAATGAAAGCTGTTGG + Intronic
1155036444 18:22028842-22028864 CTGAGAAAACTCCAGGATGCCGG + Intergenic
1155581519 18:27313533-27313555 ATGAGAAAACTGAAGCTTGTTGG + Intergenic
1155844487 18:30688516-30688538 TTGTGAAAACTGATGAATGTTGG - Intergenic
1156633557 18:38998500-38998522 ATCAGTAAACTGAAGGATATAGG - Intergenic
1156648242 18:39193718-39193740 ATGAGAAAATTGAAGGCAGTTGG + Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1158268513 18:55686694-55686716 ATGAGAAAACTGAAGAGTTTGGG - Intergenic
1158424294 18:57325083-57325105 CTGAGCAAACTCATGGATGAAGG - Intergenic
1159199692 18:65167912-65167934 CTGGGAAAACGGAAGCAAGTTGG + Intergenic
1160041861 18:75352797-75352819 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1160258344 18:77266356-77266378 CTGAGAAGACAGGAAGATGTGGG - Intronic
1163350008 19:16770623-16770645 ATGGGAAAACTGAGGGCTGTGGG - Intronic
1165260314 19:34609763-34609785 CTGAGAAAAATGAAAAAAGTTGG - Intronic
1165536580 19:36452340-36452362 TTGAGAAAACTGAAGGCTTTAGG + Intronic
1202654674 1_KI270708v1_random:9239-9261 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
925560110 2:5182507-5182529 CTGAGAAGACAGGAAGATGTGGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927863584 2:26575360-26575382 ATGAGATAACTGCAGAATGTGGG + Intronic
929211345 2:39360382-39360404 CTCAGAAGACAGAAAGATGTGGG - Intronic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
932551639 2:72775912-72775934 CATAGAAAACTGAATAATGTAGG + Intronic
935036343 2:99378358-99378380 CTCAGAAAGCTGAAGCATTTAGG + Intronic
935479156 2:103562924-103562946 CTCAGAAGACAGAAAGATGTGGG - Intergenic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
937771878 2:125728982-125729004 CTGACCAAACAGCAGGATGTGGG + Intergenic
938894776 2:135739182-135739204 CTGAAAGAAGTGAAGGATGGTGG - Intergenic
939018805 2:136933725-136933747 GTGATAATACTGAAGGATGGGGG - Intronic
940136807 2:150446377-150446399 GAGAGAAAACTGAAGCCTGTGGG - Intergenic
940691227 2:156923280-156923302 CTCAGAAAACAGGAAGATGTGGG + Intergenic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941153614 2:161947097-161947119 CTGAGGAAACTGAAGCATAAAGG - Intronic
941336739 2:164254975-164254997 CTGGGCAAACTCAAGGAGGTAGG + Intergenic
942234225 2:173888824-173888846 CTCAGAAGACAGAAAGATGTGGG + Intergenic
942283289 2:174389230-174389252 CTCAGAAAACAGGAAGATGTGGG + Intronic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944494122 2:200289197-200289219 ATGAGAAGACTGAAGGATCTAGG - Intergenic
944940606 2:204621194-204621216 CTAAAAAAACTGAAAGCTGTAGG + Intronic
945730178 2:213523586-213523608 CTTAGAAAACTGGAAGATGTGGG + Intronic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
947102930 2:226640593-226640615 CTGAAAAAACTGAAGAATTGTGG + Intergenic
947989969 2:234479102-234479124 CTAAGATAACTGAAGGAGGCTGG - Intergenic
948257270 2:236577461-236577483 CTGAGAATACTGAAGGCTGCTGG + Intronic
1169485601 20:6028977-6028999 CTCAGCCAACTGAAGGATATGGG - Intronic
1170731823 20:18982678-18982700 CTGAGATAACTAGAGGAAGTAGG + Intergenic
1170766259 20:19292032-19292054 CTGAGCAGAGTGATGGATGTAGG + Intronic
1170776962 20:19383558-19383580 CTGAGAGGACTGAGGAATGTGGG + Intronic
1170987699 20:21273643-21273665 ATAAGAAAACAGAAGGCTGTGGG + Intergenic
1172820234 20:37726081-37726103 CTGAGAAAACTGAAGCGTAGAGG + Intronic
1173087274 20:39935468-39935490 CTCAGAAATCTGGAGAATGTAGG + Intergenic
1174060869 20:47832221-47832243 CTTAAAAAACTAAAGGATGTTGG - Intergenic
1174071029 20:47899149-47899171 CTTAAAAAACTAAAGGATGTTGG + Intergenic
1174100075 20:48120635-48120657 CTAAAAAAACTAAAGGATGTTGG - Intergenic
1174148828 20:48471699-48471721 TTAAAAAAACTAAAGGATGTTGG - Intergenic
1175018992 20:55824466-55824488 CTGGGAAAACTGAGGCATGGAGG - Intergenic
1176632959 21:9157135-9157157 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
1177557048 21:22704041-22704063 CTCAGAAAACAGGAAGATGTGGG + Intergenic
1178261965 21:31107850-31107872 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1178338361 21:31764180-31764202 ATGAGGAAACTGAGGGCTGTAGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1179794887 21:43776808-43776830 CCGAGAACACTGAAGGCTGAAGG + Intergenic
1180349384 22:11787072-11787094 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
1180373671 22:12070525-12070547 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
1180388828 22:12205157-12205179 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1180934335 22:19614672-19614694 GTCAGAAAGCTGAAGGCTGTGGG - Intergenic
1181768403 22:25108711-25108733 ATGAGAAAACTGAAGATTGAAGG - Intronic
1182329688 22:29542428-29542450 CTTAGAAAACTGTAGGATCTGGG - Intronic
1182999500 22:34843453-34843475 CTCAGAAGACAGAAGGATTTGGG + Intergenic
1183071224 22:35397837-35397859 CTGAGAAAACTCAAGGCTGCTGG - Intergenic
1183151315 22:36039930-36039952 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1185417256 22:50717010-50717032 ATGAGAAAACTGAAGCAAGGAGG + Intergenic
950320427 3:12047387-12047409 CTGAGAAGAAGGAAGGATGATGG + Intronic
951850874 3:27138518-27138540 AAGAGAAATCTAAAGGATGTAGG - Intronic
952223647 3:31351277-31351299 GTGAGAAAACTGAAGCATAAAGG - Intergenic
952469941 3:33637022-33637044 CTGAGAAAACTTAAATACGTAGG + Intronic
952608808 3:35182322-35182344 CTCAGAAAACAGGAAGATGTGGG - Intergenic
953332856 3:42068864-42068886 ATGAGAAAACTGAGGGTTGTAGG + Intronic
953687064 3:45086180-45086202 CTGAGCAATCTGAGGGATTTGGG - Intronic
953992499 3:47495214-47495236 CTGTGAAGACTGCAGGAGGTGGG - Intergenic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
954484715 3:50837082-50837104 CTCAGAAGACAGAAAGATGTGGG - Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
954625770 3:52021173-52021195 CTGGGAAGGCTAAAGGATGTAGG + Intergenic
955046061 3:55360834-55360856 CTGAGAAATCTGATGGATAATGG + Intergenic
955216978 3:56992284-56992306 CTGTGAAATCTGAAGAATGAAGG + Intronic
955873484 3:63464698-63464720 TGGAGAAAACTGGAAGATGTGGG - Intronic
956896897 3:73670436-73670458 TTGAGAAAACCTAAGGTTGTGGG + Intergenic
957099827 3:75813070-75813092 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
957115458 3:76018893-76018915 CAGAGAAAACCGAACCATGTGGG - Intronic
957115493 3:76019253-76019275 CAGAGAAAACTTAACCATGTAGG - Intronic
957115503 3:76019343-76019365 CAGAGAAAACCGAACCATGTGGG - Intronic
957115512 3:76019433-76019455 CAGAGAAAACCAAAGCATGTGGG - Intronic
957115521 3:76019523-76019545 CAGAGAAAACTGAACCATGTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957418900 3:79942799-79942821 CAGAAAATACTGAAGGAGGTAGG - Intergenic
957800195 3:85068328-85068350 CTGATGAAACTGAAGGAACTGGG + Intronic
958057076 3:88427045-88427067 CTCAGAAGACAGAAAGATGTGGG + Intergenic
958128298 3:89385807-89385829 CTTAGAAGACAGAAAGATGTGGG + Intronic
958466024 3:94459798-94459820 CTGAGAAAACTTAAGCAGGTAGG - Intergenic
958875193 3:99608614-99608636 CATAGGAAAATGAAGGATGTTGG + Intergenic
959139944 3:102473467-102473489 CTGAGAAAACTCTAGCATGTTGG - Intronic
959210184 3:103368988-103369010 CTGAGAGAAGTGAAGAAGGTGGG - Intergenic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
961200674 3:125043059-125043081 CTAAGAAAAATCAAGCATGTTGG + Intronic
961503905 3:127357546-127357568 CTCAGAAGACTGGAAGATGTGGG - Intergenic
962404588 3:135089988-135090010 CTGACAAACCTGAAGGCAGTTGG + Intronic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
964897119 3:161612078-161612100 CTCAGAAGACAGAAAGATGTGGG + Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
1202746539 3_GL000221v1_random:107335-107357 CTGAGAAAGCTGATGGCTATAGG - Intergenic
969137296 4:5040288-5040310 CTGAAAAAAATGAAGGAGTTGGG - Intergenic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
970239094 4:13989416-13989438 CTGAGAAACCTCTAGGAAGTAGG - Intergenic
970874711 4:20856029-20856051 AGGAGAAAATTGAAGGATTTTGG - Intronic
970990950 4:22212494-22212516 CTGAAAAAGCTGGAGGAAGTGGG - Intergenic
971011243 4:22438194-22438216 CTTAGACAACAGAAGGATCTGGG + Intronic
971288949 4:25317822-25317844 ATGAGAAAACTGAAGCTTATAGG + Intronic
972032700 4:34481511-34481533 ATGAGAAAACTGAGGCATGTAGG + Intergenic
972056283 4:34806884-34806906 CTCAGAAAACAGGAAGATGTGGG - Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973112369 4:46412051-46412073 GTGGGAAAACTGAAGGTTGTTGG + Intronic
973887338 4:55336629-55336651 CTGTGATAACTGAAAAATGTGGG + Intergenic
974314098 4:60255311-60255333 CTGAGAAAATAGAAGGTAGTTGG - Intergenic
975204148 4:71624764-71624786 CTCAGAAGACAGAAAGATGTGGG - Intergenic
976291017 4:83417506-83417528 GTGAGAACACTGAAAGATATTGG - Intronic
976726579 4:88221511-88221533 CTTAGAAGACAGGAGGATGTGGG + Intronic
976947671 4:90790762-90790784 CTCAGAAGACAGGAGGATGTGGG - Intronic
977046301 4:92072297-92072319 AGGAGAAAACAGAAAGATGTGGG - Intergenic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977356486 4:95953226-95953248 CTCAGAAGACAGGAGGATGTGGG - Intergenic
977920906 4:102641436-102641458 CTGAGACTACTGAAGGAGGAAGG + Intronic
978215027 4:106189873-106189895 CTGAAACAGCTGAAGGAAGTTGG - Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978958710 4:114648171-114648193 CTGAGTAAGCTGAAATATGTTGG - Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
980702440 4:136450235-136450257 CTGAGAAAGCTCAATGTTGTGGG + Intergenic
981184335 4:141783226-141783248 CTCAGAAAACAGGAAGATGTGGG - Intergenic
983766270 4:171488779-171488801 CTCAGAAGACAGAAAGATGTGGG + Intergenic
983847319 4:172536360-172536382 CTCAGAAGACAGAAAGATGTGGG + Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
1202755245 4_GL000008v2_random:55964-55986 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
986507873 5:8471441-8471463 CTCAGAAGACAGAAAGATGTGGG - Intergenic
986640704 5:9869029-9869051 CTCAGAAAACAGGAAGATGTGGG - Intergenic
987043149 5:14082054-14082076 CTGAGAAAACTGCTGGAGTTTGG + Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987856968 5:23432434-23432456 CTGAGCACACTGAAGTATTTAGG - Intergenic
988353586 5:30143544-30143566 CTCAGAAAACAGGAAGATGTGGG - Intergenic
988396229 5:30700410-30700432 CTCAGAAGACGGAAAGATGTGGG + Intergenic
988448536 5:31315505-31315527 CTGAGATAAATGAAGTATTTTGG - Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989291225 5:39768647-39768669 CTGAGAAGAGTGAAGGATTATGG - Intergenic
989523729 5:42428867-42428889 CTCAGAAAACAGGAAGATGTGGG - Intronic
990598310 5:57332851-57332873 CTGAAAAAAATTAATGATGTTGG + Intergenic
990794430 5:59524227-59524249 CTCAGAAGACAGAAAGATGTGGG + Intronic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
991254386 5:64598271-64598293 ATGAGACAACTGAAAGATGAGGG - Intronic
991598954 5:68333548-68333570 CCAAGAAAACTGGAGCATGTAGG + Intergenic
991994000 5:72369494-72369516 ATTAGAAAAGTGAAAGATGTTGG + Intergenic
992541712 5:77771910-77771932 GAGAGAAAATTGAAGGATTTGGG + Intronic
992901838 5:81304386-81304408 CCGGGAAAACTGCAGAATGTGGG + Exonic
993172742 5:84440140-84440162 TTGAGAAAACTGAAGTCTCTTGG + Intergenic
994590859 5:101769834-101769856 CTCAGAATACAGAAAGATGTCGG - Intergenic
994764441 5:103899439-103899461 CTCAGAAAACAGGAAGATGTGGG + Intergenic
995357052 5:111250785-111250807 ATGAGAAAACTGAAGGGTAGGGG - Intronic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995453700 5:112330591-112330613 ATGAGAAAACTGAGGAATGGGGG + Intronic
996543614 5:124654707-124654729 GTGAGAGAACTGATGAATGTGGG + Intronic
996783018 5:127208977-127208999 ATGAGAAAACTGAAGTATCTTGG - Intergenic
998019743 5:138759474-138759496 AAGAGAAAAATGAAGGAAGTAGG + Intronic
999178628 5:149652529-149652551 CTGAGACCACTGAAGGATCATGG + Intergenic
999403235 5:151283656-151283678 CTTGGAAAAATGAAGGCTGTGGG + Intronic
999773486 5:154792906-154792928 ATGGGGAAACTGATGGATGTAGG + Intronic
1000392414 5:160738327-160738349 GTGTGAAAACTCAAGGATCTAGG + Intronic
1000745204 5:165024421-165024443 CTGATAAAACTGAATAATGGTGG - Intergenic
1002171690 5:177378277-177378299 CTGTGAAAACTGTAGGGTCTGGG + Intergenic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1003014395 6:2456208-2456230 CTTAGAAAACCTAAGGACGTAGG + Intergenic
1003168264 6:3700164-3700186 CTGGGAAGGCTGAGGGATGTGGG - Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1005850323 6:29815957-29815979 ATGAGAGAGCTGAAGGATGTGGG + Intergenic
1005862941 6:29915220-29915242 ATTAGAGAGCTGAAGGATGTGGG + Intergenic
1005874453 6:30000408-30000430 ATTAGAGAGCTGAAGGATGTGGG + Intergenic
1006761041 6:36460933-36460955 ATAAGAAAACTGAAGGAAGAAGG - Intronic
1008831781 6:55773022-55773044 CTGAGAAAAATGAAGATTTTAGG + Intronic
1010174236 6:73007885-73007907 AAAAGAAAAATGAAGGATGTGGG - Intronic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1010605866 6:77889236-77889258 CTGAGAAGACAGGAAGATGTGGG + Intronic
1011143083 6:84181759-84181781 CTGAGAGAAATTAAGGTTGTAGG + Intronic
1011502732 6:88008658-88008680 ATGAGAAAACTGAAAGAAGCAGG - Intergenic
1011512064 6:88112437-88112459 CTGAGACAACAGAAGGGTTTTGG - Intergenic
1012097273 6:94978030-94978052 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1012363197 6:98408471-98408493 CTGGGAAAACTAAAGGCAGTGGG - Intergenic
1012514118 6:100038887-100038909 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012768220 6:103396634-103396656 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1012962841 6:105640817-105640839 CTGAAAGAACTTAAAGATGTTGG - Intergenic
1013712092 6:112913592-112913614 GTGACAAAACTGAATGAGGTAGG + Intergenic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1016444001 6:144114048-144114070 CTGAGAAATTTAAAGGATATAGG - Intergenic
1017495059 6:154976440-154976462 CTGAGAATGTAGAAGGATGTTGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019585804 7:1802759-1802781 TTGAGGAAACTGAAAGGTGTGGG - Intergenic
1019767575 7:2863154-2863176 CAGAGAAGACTGCAGGAAGTGGG - Intergenic
1021697433 7:23288205-23288227 CTGAGAAAACTCAAAGCTGGGGG + Intergenic
1022319257 7:29273091-29273113 GAGAGAAAACGGAAAGATGTAGG - Intronic
1022780887 7:33582139-33582161 CTGAGATAACTCAAGGACTTAGG - Intronic
1023632679 7:42179545-42179567 GTGAGGAAACTGAGGGCTGTTGG + Intronic
1024566813 7:50688219-50688241 CTGGGAAAACTGAAAGATGTTGG - Intronic
1025234064 7:57221789-57221811 TTAAAAAAACTAAAGGATGTTGG + Intergenic
1025277121 7:57592725-57592747 CTGAGAACTCTGTAGTATGTCGG - Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1028084141 7:86616238-86616260 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1030396949 7:108997565-108997587 TTGAGAAAACTAAAGCATGCGGG + Intergenic
1030437835 7:109547653-109547675 ATGAGCACAGTGAAGGATGTAGG + Intergenic
1031148858 7:118029210-118029232 CTGAGATAAATGGAGGACGTAGG + Intergenic
1031637468 7:124119251-124119273 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1032149858 7:129419174-129419196 CTGTGAATACTGAAGGATCTGGG + Intronic
1032296124 7:130639964-130639986 CTGAGAAAAGGGACGGCTGTTGG - Intronic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1033628866 7:143138056-143138078 CTGAGCAAGCTGCAGGAGGTGGG + Intronic
1034253186 7:149708676-149708698 CTGTGAAAACTGAAGCACCTTGG - Intergenic
1034510829 7:151533262-151533284 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1035639718 8:1175612-1175634 CTGAGAAATTTGGAGGGTGTTGG + Intergenic
1036943984 8:13077169-13077191 CTTTTAAAACTGAAGGCTGTGGG - Intergenic
1037026609 8:14045881-14045903 CTGAGATAATTGAATGATGGGGG + Intergenic
1037621885 8:20571227-20571249 CTAAGAATACTGGAGGATGCTGG + Intergenic
1037860401 8:22401033-22401055 ATGAGAAAACTGAAGGTAGAGGG + Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038136081 8:24787134-24787156 GTGAGAAAACTGAGGTGTGTGGG + Intergenic
1038153459 8:24963974-24963996 CTTATAAAACTGAAAGATTTAGG - Intergenic
1038306945 8:26413496-26413518 CAGAGGAAACTGAAAAATGTAGG + Intronic
1038880547 8:31606140-31606162 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1038965068 8:32562609-32562631 CTGAGAGGGCTGAAGGATGACGG + Intronic
1041146278 8:54879861-54879883 CTGAGAAAATTGAAATATTTTGG + Intergenic
1041704894 8:60836189-60836211 CTGCCAAAACTGAAGGCTGGTGG + Exonic
1042226602 8:66519629-66519651 CTGAGAAGTCTGAGGGGTGTGGG - Intergenic
1042472611 8:69208714-69208736 CTGAGAAATCTGAAGGGAGCTGG - Intergenic
1042622146 8:70718116-70718138 CTCAGAAAACTGGAAGATGTGGG - Intronic
1042723649 8:71849520-71849542 TGGAGAATCCTGAAGGATGTTGG + Intronic
1043823657 8:84899032-84899054 GTGAGTAGACTGAGGGATGTTGG + Intronic
1044149030 8:88751187-88751209 CTGTGATTACTGAAGGATTTGGG + Intergenic
1045665951 8:104484741-104484763 GTGAGAAAACTGAATGATTGTGG + Intergenic
1046159427 8:110341059-110341081 CTTAAAAAACTGAGGGATGTTGG - Intergenic
1046311338 8:112441363-112441385 CTCAGAATACAGAAAGATGTGGG - Intronic
1046358278 8:113116696-113116718 CTCAGAAAACAGGAAGATGTTGG + Intronic
1047803325 8:128332513-128332535 CTGACAAAACTGAAGGATGTAGG - Intergenic
1048273696 8:133049677-133049699 CTCAGTAAAATGAAGGAAGTTGG - Intronic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1050363148 9:4850352-4850374 CTGTGATAACTGAAGAATGGTGG + Intronic
1052526776 9:29628959-29628981 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1053023151 9:34709477-34709499 GTGAGGAATCTGAGGGATGTGGG - Intronic
1055087160 9:72326040-72326062 CTGAGCAAAGTCAAGAATGTAGG + Intergenic
1055849884 9:80613501-80613523 ATAAGAAAACTGAAAGATGATGG - Intergenic
1056335059 9:85560171-85560193 CTTAGCAAAGTGAAGGAAGTTGG - Intronic
1057127383 9:92629092-92629114 CTGAAAAAAAAGAATGATGTCGG + Intronic
1058806186 9:108594344-108594366 ATGAGAAAACTGAGGGATGAGGG - Intergenic
1058934052 9:109751373-109751395 CTGAGAAAACTGAAGTGAGCAGG - Intronic
1059211809 9:112519684-112519706 CTCAAAGAACTGAAGGATTTGGG - Intronic
1060274145 9:122169594-122169616 CTGAGGAAGCTGAAGGCTTTTGG - Intronic
1061714018 9:132507517-132507539 CTGACAAATGTGAAGGATGCAGG + Intronic
1203686848 Un_GL000214v1:2949-2971 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
1203755794 Un_GL000218v1:124758-124780 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
1203536052 Un_KI270743v1:40799-40821 CTGGGAAAGCTGATGGCTGTAGG + Intergenic
1203649427 Un_KI270751v1:101104-101126 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
1186117085 X:6316033-6316055 CTCAGAAAACTGAATGAGGGGGG - Intergenic
1186626719 X:11302239-11302261 CTGATAAAACTGAATGGTGATGG - Intronic
1188457048 X:30379155-30379177 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1190798201 X:53763462-53763484 ATTAGAAAATTGAAGGATGATGG - Intergenic
1191188497 X:57639500-57639522 CTCAGAAGACTGAAAGATTTGGG + Intergenic
1191211544 X:57890134-57890156 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1191722567 X:64246582-64246604 CTAAGAAAACAGAAAGAAGTAGG - Intergenic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1193008045 X:76643280-76643302 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1193173619 X:78365987-78366009 TTGAGAAAACTGAAGGAAAGAGG + Intergenic
1193678307 X:84484055-84484077 CTCAGAAGACAGAAAGATGTAGG - Intronic
1193840782 X:86405566-86405588 CTCAGAAAACAGGAAGATGTGGG - Intronic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1194054770 X:89117913-89117935 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1194084267 X:89506432-89506454 CTTAGAAGACAGAAAGATGTGGG - Intergenic
1194085409 X:89520969-89520991 CTAAGAAAAATGAAGAAAGTTGG - Intergenic
1194850127 X:98859214-98859236 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1195085511 X:101409687-101409709 TTGAGAGAACTGAAGGGTGGGGG - Intronic
1195662128 X:107389405-107389427 TTGAGAAAATGGATGGATGTTGG + Intergenic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1197478576 X:126953251-126953273 CTGAAAAAACTTGAGAATGTTGG - Intergenic
1197594537 X:128450236-128450258 CTCAGAAAACAGGAAGATGTGGG - Intergenic
1198960990 X:142182993-142183015 CTGAGAAATGTACAGGATGTGGG + Intergenic
1199155125 X:144537557-144537579 CTCAGAAGACAGAAAGATGTGGG - Intergenic
1199306103 X:146269202-146269224 CTCAGAAGACAAAAGGATGTGGG + Intergenic
1199357076 X:146875099-146875121 CTCAGAAGACAGAAAGATGTGGG + Intergenic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200380228 X:155829487-155829509 CTGATACAAACGAAGGATGTGGG - Intergenic
1200436906 Y:3162319-3162341 CTTAGAAGACAGAAAGATGTGGG - Intergenic
1200438052 Y:3176846-3176868 CTAAGAAAAATGAAGAAAGTTGG - Intergenic
1201169398 Y:11242365-11242387 CTGGGAAAGCTGATGGCTGTAGG - Intergenic
1202301153 Y:23415892-23415914 CTGAGCAAGCTGAAGAATGGAGG + Intergenic
1202569658 Y:26254706-26254728 CTGAGCAAGCTGAAGAATGGAGG - Intergenic