ID: 995452832 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:112321319-112321341 |
| Sequence | CTGCAGTAACACAATGACCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995452828_995452832 | 4 | Left | 995452828 | 5:112321292-112321314 | CCTGACCTGCTTTTCTTCTCACC | 0: 1 1: 0 2: 4 3: 36 4: 398 |
||
| Right | 995452832 | 5:112321319-112321341 | CTGCAGTAACACAATGACCAAGG | No data | ||||
| 995452829_995452832 | -1 | Left | 995452829 | 5:112321297-112321319 | CCTGCTTTTCTTCTCACCTTTCC | 0: 1 1: 0 2: 11 3: 101 4: 931 |
||
| Right | 995452832 | 5:112321319-112321341 | CTGCAGTAACACAATGACCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995452832 | Original CRISPR | CTGCAGTAACACAATGACCA AGG | Intronic | ||
| No off target data available for this crispr | |||||