ID: 995452832

View in Genome Browser
Species Human (GRCh38)
Location 5:112321319-112321341
Sequence CTGCAGTAACACAATGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995452828_995452832 4 Left 995452828 5:112321292-112321314 CCTGACCTGCTTTTCTTCTCACC 0: 1
1: 0
2: 4
3: 36
4: 398
Right 995452832 5:112321319-112321341 CTGCAGTAACACAATGACCAAGG No data
995452829_995452832 -1 Left 995452829 5:112321297-112321319 CCTGCTTTTCTTCTCACCTTTCC 0: 1
1: 0
2: 11
3: 101
4: 931
Right 995452832 5:112321319-112321341 CTGCAGTAACACAATGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995452832 Original CRISPR CTGCAGTAACACAATGACCA AGG Intronic
No off target data available for this crispr