ID: 995456207

View in Genome Browser
Species Human (GRCh38)
Location 5:112354978-112355000
Sequence CAAAATAAACAAAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2633
Summary {0: 1, 1: 0, 2: 10, 3: 188, 4: 2434}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995456207 Original CRISPR CAAAATAAACAAAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr