ID: 995457759

View in Genome Browser
Species Human (GRCh38)
Location 5:112369906-112369928
Sequence CAGACCTACACCTCAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995457759_995457762 0 Left 995457759 5:112369906-112369928 CCCACCTCTGAGGTGTAGGTCTG 0: 1
1: 0
2: 1
3: 8
4: 124
Right 995457762 5:112369929-112369951 AAGAACTGTTTCCACCTTTATGG 0: 1
1: 0
2: 1
3: 22
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995457759 Original CRISPR CAGACCTACACCTCAGAGGT GGG (reversed) Intronic
903928538 1:26848986-26849008 CTGCCCCACACCTCAGAGCTGGG - Intronic
908785116 1:67728073-67728095 CATACCTGCACTTAAGAGGTAGG + Intronic
908980345 1:69949181-69949203 CAGTCCCACCCCCCAGAGGTAGG + Intronic
911414956 1:97560086-97560108 CACACCTAGACCTCAGATGAAGG + Intronic
914796766 1:150926450-150926472 CAGACTCACAACTCAGGGGTCGG - Exonic
915440279 1:155941551-155941573 CACGCCCACACCTCAGAGGGAGG - Intergenic
915778711 1:158521367-158521389 CAAACCTTGACCTCAGAGGCAGG + Intergenic
918047236 1:180948930-180948952 CAAACCCACACTTCAGAGGCAGG + Exonic
919587288 1:199454792-199454814 CAGACCTACACGTCCCAGGAGGG - Intergenic
920199308 1:204249742-204249764 CAGGACTAGACCTCAGAGGGAGG - Intronic
921708159 1:218347068-218347090 CAGAGCTAAACCTCAGGGGATGG - Intronic
922011213 1:221590104-221590126 CAGACCAACACCTGAGTGGTAGG - Intergenic
1065872607 10:29968513-29968535 CAGACCTTCGCCTCTGAGGCTGG - Intergenic
1067448613 10:46367919-46367941 CAGGCCTGCACCCCAGAAGTAGG + Intergenic
1067518471 10:46975492-46975514 CATACTGACACCTTAGAGGTAGG - Intronic
1067588758 10:47492846-47492868 CAGGCCTGCACCCCAGAAGTAGG - Intergenic
1067635884 10:48000937-48000959 CAGGCCTGCACCCCAGAAGTAGG - Intergenic
1067643779 10:48076336-48076358 CATACTGACACCTTAGAGGTAGG + Intergenic
1067877610 10:50019390-50019412 CAGGCCTGCACCCCAGAAGTAGG + Intergenic
1068483942 10:57631983-57632005 CACACCTACACCTCTGATCTTGG - Intergenic
1070132446 10:73664944-73664966 CAGGCCTGCACCCCAGAAGTAGG - Intergenic
1070374681 10:75818170-75818192 CATACCCACACCTTAGAGTTAGG + Intronic
1071372483 10:84966522-84966544 CAGACCCACACCTGAGAGAAAGG - Intergenic
1071609234 10:87019132-87019154 CAGGCCTGCACCCCAGAAGTAGG + Intergenic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1072745983 10:97939490-97939512 CAGACCAACAGCTCCTAGGTTGG + Intronic
1073256096 10:102152253-102152275 CCCACCTTCACCTCAGAGGTAGG - Exonic
1073696230 10:105871855-105871877 GAGACCTACTGCTCAGAGGAGGG - Intergenic
1079130563 11:17744682-17744704 CAGCCCTACACCATAGAAGTTGG - Intronic
1079230479 11:18644988-18645010 CTGACCTAGACCCCAGAGGAAGG + Intergenic
1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG + Intergenic
1087878136 11:103383051-103383073 CAGACTTAGACCTCTGAGGAAGG + Intronic
1093587744 12:20861375-20861397 CAGACCTCCACATCGGTGGTGGG - Intronic
1093805690 12:23430673-23430695 CATACCAAAACCACAGAGGTGGG + Intergenic
1094400917 12:30059711-30059733 CAGCCCTACACTTCAGCTGTGGG - Intergenic
1100865626 12:98853873-98853895 CAGACCTAAACCTGAGATGGTGG + Intronic
1103331824 12:120159595-120159617 AAAACCTACTCCTCAGAGGGAGG + Intronic
1109801926 13:67391134-67391156 CACACATACACTTCAGAGATAGG + Intergenic
1110280571 13:73688876-73688898 CAGACCTCCAGGTCAGAGATAGG + Exonic
1111430751 13:88145840-88145862 CAGAACTAGACTCCAGAGGTGGG - Intergenic
1116242954 14:42370301-42370323 AAGATCTAAACCTCAGAGGAGGG - Intergenic
1120707824 14:87762437-87762459 CAGCCCTTCACATCACAGGTTGG - Intergenic
1121555343 14:94832248-94832270 CGGCCCCACACCTCTGAGGTGGG + Intergenic
1122128415 14:99591515-99591537 CTGCCCTGCACCTCAGAGGAAGG + Intronic
1124035241 15:26048536-26048558 GAGAACTACAGCCCAGAGGTAGG - Intergenic
1124429716 15:29596043-29596065 CATACCTACTGCTCAGAGCTTGG - Intergenic
1124546684 15:30634790-30634812 CAGACCTACACATAAAAAGTTGG - Intronic
1124780289 15:32624790-32624812 CAGACCTACACATAAAAAGTTGG - Intronic
1127455194 15:59150621-59150643 CAGACCTACACCTTTCAGGTGGG - Intronic
1127632307 15:60838471-60838493 CAGCCCTGCACCACAGAGGCTGG - Intronic
1129965250 15:79729226-79729248 CAGAACTAAAACTCAGAGATGGG - Intergenic
1132649983 16:1016234-1016256 CAGACCAGCACCTCAGTGGTTGG - Intergenic
1138816288 16:60206585-60206607 CAAATCTACACCTTAGAGGAAGG + Intergenic
1139975485 16:70806703-70806725 CAGACATACACCTCTGACGGAGG - Intergenic
1140433424 16:74924567-74924589 AAGAACTGCACCTCAGATGTTGG - Intronic
1141140788 16:81495587-81495609 CAGACCCACTTCTCAGAGGGTGG + Intronic
1142244591 16:88964020-88964042 CAGCCCTGCACCTGTGAGGTAGG + Intronic
1142868900 17:2808041-2808063 CAGGCCTCCATCTCACAGGTTGG - Intronic
1146592570 17:34140458-34140480 CATACCTACAACTCAGATCTTGG + Intronic
1146747420 17:35344789-35344811 GTGACACACACCTCAGAGGTAGG - Intergenic
1148124903 17:45231515-45231537 CAGCCTGACATCTCAGAGGTTGG + Intronic
1149367428 17:55959901-55959923 CAGACCACCACATCAGAGTTGGG + Intergenic
1152696598 17:81800754-81800776 CAAACCCACATCTCAGGGGTGGG + Intergenic
1156491837 18:37500990-37501012 CAGCCCCACACCTCACAGGAAGG - Intronic
1156872802 18:41966987-41967009 CTGACCTTCACCTCAGAAGAAGG + Intronic
1159180759 18:64900975-64900997 CTGACCAACCCTTCAGAGGTAGG + Intergenic
926213685 2:10890416-10890438 CAGGTCTGCACCTCAGAGTTAGG - Intergenic
929123679 2:38503753-38503775 GAGACCTAAACCTGAGAGCTGGG - Intergenic
929788420 2:45007845-45007867 CCGACCTACCCATCAGAGGTAGG + Intronic
937751912 2:125486044-125486066 GAGACTGACACCTCAGAGGCAGG - Intergenic
944557220 2:200899451-200899473 CTGACCTTTACCTCACAGGTAGG + Exonic
948085137 2:235241168-235241190 CAGGCCAACACTTCAGAGGTAGG - Intergenic
948999884 2:241607190-241607212 CAGGCCTGGAACTCAGAGGTGGG + Intronic
1169915320 20:10676881-10676903 CATACCTACACCTGAGAGAAGGG + Intergenic
1170030682 20:11940736-11940758 CAGAACTACATCTCAGATGGTGG - Intergenic
1170947973 20:20909115-20909137 CAGACCCACACCTCAGAGAAAGG + Intergenic
1172725857 20:37040813-37040835 AAGAACTAAACCTCTGAGGTAGG + Intronic
1175880596 20:62256374-62256396 CTGACATCCATCTCAGAGGTGGG + Intronic
1179948299 21:44695360-44695382 CAGACCTTCTACTGAGAGGTCGG + Intronic
1181018198 22:20083431-20083453 CAGCCCCAGACCTCAGTGGTGGG - Intronic
1181123434 22:20688212-20688234 AAGACCTACACTTGAGAGCTGGG - Intergenic
949484670 3:4526657-4526679 AAGACCTACACCTCATAGGTGGG - Intronic
952848454 3:37708489-37708511 TATACCTACCGCTCAGAGGTTGG - Intronic
953767519 3:45754999-45755021 CAGAGCCTCACCTCAGAGGGGGG - Intergenic
955502053 3:59595331-59595353 CAGACCAACACCCAAGAGGAGGG - Intergenic
958108233 3:89105127-89105149 TGGACCTAAACCTCCGAGGTTGG - Intergenic
960140989 3:114151774-114151796 GAGAAACACACCTCAGAGGTGGG - Intronic
960696618 3:120402663-120402685 CAGACCCACACCTGTAAGGTTGG - Intronic
961209542 3:125115176-125115198 CACACATACACCTGAGAGCTGGG + Intronic
962708101 3:138064067-138064089 CAGACTTAGAGCTCAGATGTTGG - Intronic
963710352 3:148739920-148739942 CTGACCTTCACCTCAGAGTGTGG + Intronic
965598335 3:170430102-170430124 CAGCCCTAAACCTCAAAAGTGGG - Intronic
967737107 3:192964880-192964902 CAGACTGACACCTCACAGGGCGG - Intergenic
967839264 3:193991639-193991661 CAGACCAACCACTCAGAGGAGGG - Intergenic
968892413 4:3376566-3376588 CAGACTTGCAGCTCAGAAGTGGG + Intronic
970424269 4:15931938-15931960 CAAACCAACACATCAGAGGATGG + Intergenic
973862835 4:55082873-55082895 CAGAACTGGACCTCAGAAGTAGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976732209 4:88274481-88274503 CAGTCCTTCACCTCACAGGAAGG + Intronic
977423161 4:96829120-96829142 CAGACCTACAGCAAAGATGTGGG - Intergenic
981000356 4:139823320-139823342 CAGCCCTCCACCTCAAAGGCAGG + Intronic
986258312 5:6120703-6120725 CGGACTAACACCTGAGAGGTGGG + Intergenic
986502159 5:8412179-8412201 CAGAGCTACATTGCAGAGGTTGG + Intergenic
993129810 5:83881212-83881234 CAGAGCCACACCTTAGTGGTGGG + Intergenic
995457759 5:112369906-112369928 CAGACCTACACCTCAGAGGTGGG - Intronic
996075756 5:119191807-119191829 AACACCTACACCACAGAGATTGG + Intronic
997425961 5:133802797-133802819 CAGACTCTCACCACAGAGGTGGG + Intergenic
998590350 5:143471529-143471551 GAGACGAACACCTCAGAGCTGGG + Intergenic
1002309103 5:178303841-178303863 CAGGCCAACACCTCAGGTGTGGG + Intronic
1003730648 6:8819057-8819079 CAAACCTAGATATCAGAGGTGGG - Intergenic
1005510009 6:26504321-26504343 AAGACCAATAACTCAGAGGTGGG - Intronic
1010583060 6:77623225-77623247 TAGAGCTTCACCCCAGAGGTAGG + Intergenic
1013024404 6:106255829-106255851 CAGAGCTACAGCACAGTGGTAGG + Intronic
1016183304 6:141173040-141173062 CAGACTTAAAGGTCAGAGGTGGG + Intergenic
1016449732 6:144169700-144169722 CAGAGCAAGACCTCATAGGTAGG - Intronic
1017820098 6:158043092-158043114 CAGACCCCCTCCTCAGAGGCTGG + Intronic
1018096384 6:160390549-160390571 CAGGCTGACACCTGAGAGGTGGG + Intronic
1019573507 7:1725046-1725068 CAGCCCTGCACCCCAGAGGGTGG + Intronic
1021392660 7:20113108-20113130 AGTACCTACACCTCATAGGTAGG + Intergenic
1021688536 7:23210863-23210885 CAGCCCTCCACCCCACAGGTGGG - Intergenic
1034974009 7:155437402-155437424 CAGAACAACAGCTCAGAGGCAGG + Intergenic
1044191207 8:89319889-89319911 CCAGCCTAAACCTCAGAGGTGGG + Intergenic
1049167179 8:141133677-141133699 CAGACCTACACCTCAGCCACTGG - Intronic
1051689095 9:19690359-19690381 AAGCCCTACAGCCCAGAGGTGGG - Intronic
1052718541 9:32147120-32147142 CAGACCTACACATCCCAGGTGGG + Intergenic
1052965758 9:34339415-34339437 CAGCCATTCACCACAGAGGTTGG - Intronic
1056999174 9:91491841-91491863 CTGACCCACACTTCAGAGCTGGG - Intergenic
1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG + Intronic
1058823357 9:108753234-108753256 GATACCTACACCTCACTGGTAGG + Intergenic
1203655209 Un_KI270752v1:17232-17254 CAGAACTGCAGCTCGGAGGTGGG - Intergenic
1186130004 X:6456259-6456281 CAGCCCTAAAGCTCAGAAGTTGG + Intergenic
1187637759 X:21250949-21250971 CAGATCTACAGGTCAGATGTTGG + Intergenic
1200042461 X:153379936-153379958 CAGACATAGAACTCAGAGTTTGG - Intergenic
1202585669 Y:26424060-26424082 CTTACCTCCACCTCTGAGGTTGG + Intergenic