ID: 995461743

View in Genome Browser
Species Human (GRCh38)
Location 5:112410719-112410741
Sequence TCTTGGGCGATAAGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 49}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995461743_995461754 29 Left 995461743 5:112410719-112410741 CCCATTGCCCTTATCGCCCAAGA 0: 1
1: 0
2: 1
3: 2
4: 49
Right 995461754 5:112410771-112410793 ACTCAAGGGAAGTCTGCTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 196
995461743_995461752 15 Left 995461743 5:112410719-112410741 CCCATTGCCCTTATCGCCCAAGA 0: 1
1: 0
2: 1
3: 2
4: 49
Right 995461752 5:112410757-112410779 ATTCTAGCTAAAAGACTCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 169
995461743_995461751 14 Left 995461743 5:112410719-112410741 CCCATTGCCCTTATCGCCCAAGA 0: 1
1: 0
2: 1
3: 2
4: 49
Right 995461751 5:112410756-112410778 CATTCTAGCTAAAAGACTCAAGG No data
995461743_995461753 26 Left 995461743 5:112410719-112410741 CCCATTGCCCTTATCGCCCAAGA 0: 1
1: 0
2: 1
3: 2
4: 49
Right 995461753 5:112410768-112410790 AAGACTCAAGGGAAGTCTGCTGG 0: 1
1: 0
2: 4
3: 16
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995461743 Original CRISPR TCTTGGGCGATAAGGGCAAT GGG (reversed) Intronic
912206583 1:107515857-107515879 GCTGGGGAGATAAGGGAAATGGG + Intergenic
912696202 1:111843974-111843996 TCTGGGGCCATATGGGGAATTGG - Intronic
920767681 1:208849271-208849293 TCTTGGGGGATTGGGGTAATTGG - Intergenic
1072563226 10:96596172-96596194 CCTAGGGTGATAAGGGCAAGTGG - Intronic
1073637725 10:105216727-105216749 GCTTGGGCGATGAGGACAATAGG + Intronic
1075855024 10:125622603-125622625 TCTTGGAAGCTAAGGCCAATGGG - Intronic
1079756360 11:24268900-24268922 TGTTGGGCTATAAGGAAAATCGG + Intergenic
1080336042 11:31197020-31197042 TCCTGAGTGATAAGGGTAATAGG - Intronic
1089115328 11:116090209-116090231 GCTTGGGAGAGAAGGGCAGTGGG - Intergenic
1092026402 12:5244566-5244588 TCCTGGGAGATAAGGACAAATGG - Intergenic
1093022732 12:14218464-14218486 TTTTGGGCCATAAGGGCCACAGG - Intergenic
1095538171 12:43276674-43276696 TCTTGGGTGATTAGGGCAGGTGG + Intergenic
1095888818 12:47216553-47216575 GCTTGGGCTATAGGGGAAATAGG - Exonic
1100148006 12:91701094-91701116 TCTGGGCTGATAAGGACAATAGG + Intergenic
1102207592 12:111101056-111101078 GCTTGGGCGATAAAAACAATGGG + Intronic
1102591664 12:113960795-113960817 TCTAGGGTGATAGGGGCACTGGG + Intronic
1130775736 15:86980001-86980023 TATTTGGAGATAAGGGCATTAGG - Intronic
1133088922 16:3388458-3388480 TAGAGGGCGATAAGCGCAATGGG - Intronic
1135129730 16:19843348-19843370 TCTTGGGAGATAATGGCTAAAGG - Intronic
1137662218 16:50218288-50218310 TCTTGGGGCATATGGGAAATGGG - Intronic
1140472116 16:75221727-75221749 TGTTGGGAGATCAAGGCAATAGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1148348255 17:46918907-46918929 TCTTGGAAGATAAGGCCAGTGGG - Intergenic
1155169268 18:23255093-23255115 TCTGGGGTGATAAGGGCAGGTGG + Intronic
1167263168 19:48470144-48470166 TCCTGGGGGACAAGGGGAATTGG - Intronic
1167673114 19:50867154-50867176 TCTTGGGGGATAATGGCAGAGGG + Intronic
929660656 2:43780807-43780829 TCTGGGGCGATTGAGGCAATGGG + Intronic
935399016 2:102640974-102640996 TCCTGAGCAATAAGGGCAATAGG - Intronic
939077569 2:137622098-137622120 TCTTGGACGATGAGGTCTATGGG - Intronic
941857421 2:170245218-170245240 TCTTAGTCGTTAAAGGCAATGGG + Intronic
952154434 3:30627426-30627448 ACTGGGGAGATGAGGGCAATTGG + Intronic
952277843 3:31894784-31894806 TCTTGAGAGAGAAGGGAAATAGG - Intronic
952409189 3:33032248-33032270 TCTGGGGCGATCAGTGCAAATGG - Intronic
953612446 3:44458496-44458518 ACTTGGGAAATAAGGGCTATGGG - Intronic
960291163 3:115886737-115886759 TCTTGGGCCATAAGTGAAGTGGG - Intronic
966764397 3:183447340-183447362 TCTTGGGCGGAAACGGCGATAGG + Intergenic
968276906 3:197447008-197447030 CCTTTGGCTATAAGGGCAAAGGG + Intergenic
974821329 4:67070273-67070295 TCTTAGGAGATAAAGCCAATAGG - Intergenic
981560124 4:146038966-146038988 TCCTAGGCGATAAGTGCTATGGG + Intergenic
981667468 4:147246050-147246072 TCTGGGGTGATTAGGGCAGTGGG - Intergenic
981706474 4:147664632-147664654 TGTTGGGGGATAGGGGCAAGGGG + Intronic
984095649 4:175429244-175429266 TCTTGGTCCATAAAGACAATGGG - Intergenic
992173538 5:74127435-74127457 TATTGGGTGAGAGGGGCAATTGG - Intergenic
995461743 5:112410719-112410741 TCTTGGGCGATAAGGGCAATGGG - Intronic
1012415920 6:99013568-99013590 TCTTGGACGATATGGGTAAAAGG - Intergenic
1015979620 6:138825914-138825936 TTTTGGGCGATAAGTTCAACTGG - Intronic
1022101575 7:27172598-27172620 TCTTGGGCAATCAGGGCCCTGGG - Intronic
1032510425 7:132467696-132467718 TCTTGGGCCATCATGGGAATAGG - Intronic
1190096370 X:47483913-47483935 TCTTGGGCCACAAGGCAAATGGG - Exonic
1190821589 X:53978271-53978293 TCCTGGGCGGTATGGGCAGTGGG - Intronic
1195178213 X:102331471-102331493 TCTTGGGCTATATGGGAATTGGG - Intergenic
1195180651 X:102355620-102355642 TCTTGGGCTATATGGGAATTGGG + Intergenic
1197220253 X:123905387-123905409 CCTTGGGGGATAAGGGCAATGGG - Intronic