ID: 995462575

View in Genome Browser
Species Human (GRCh38)
Location 5:112419325-112419347
Sequence TCCTCCGAAGGCGGGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995462567_995462575 -1 Left 995462567 5:112419303-112419325 CCGCGCATCCTGCGGCTCGAGCT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 995462575 5:112419325-112419347 TCCTCCGAAGGCGGGGGCGCGGG 0: 1
1: 0
2: 0
3: 16
4: 96
995462568_995462575 -9 Left 995462568 5:112419311-112419333 CCTGCGGCTCGAGCTCCTCCGAA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 995462575 5:112419325-112419347 TCCTCCGAAGGCGGGGGCGCGGG 0: 1
1: 0
2: 0
3: 16
4: 96
995462566_995462575 0 Left 995462566 5:112419302-112419324 CCCGCGCATCCTGCGGCTCGAGC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 995462575 5:112419325-112419347 TCCTCCGAAGGCGGGGGCGCGGG 0: 1
1: 0
2: 0
3: 16
4: 96
995462565_995462575 1 Left 995462565 5:112419301-112419323 CCCCGCGCATCCTGCGGCTCGAG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 995462575 5:112419325-112419347 TCCTCCGAAGGCGGGGGCGCGGG 0: 1
1: 0
2: 0
3: 16
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995462575 Original CRISPR TCCTCCGAAGGCGGGGGCGC GGG Intergenic