ID: 995463903

View in Genome Browser
Species Human (GRCh38)
Location 5:112431097-112431119
Sequence AAACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995463898_995463903 20 Left 995463898 5:112431054-112431076 CCACTCTACCCCATAATCTCGTT No data
Right 995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG No data
995463901_995463903 11 Left 995463901 5:112431063-112431085 CCCATAATCTCGTTTTGGTTGCT No data
Right 995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG No data
995463902_995463903 10 Left 995463902 5:112431064-112431086 CCATAATCTCGTTTTGGTTGCTG No data
Right 995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG No data
995463900_995463903 12 Left 995463900 5:112431062-112431084 CCCCATAATCTCGTTTTGGTTGC No data
Right 995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995463903 Original CRISPR AAACCCTGCTTCACAAAGAT AGG Intergenic