ID: 995473833

View in Genome Browser
Species Human (GRCh38)
Location 5:112528659-112528681
Sequence AAGGTCCTGTTAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995473826_995473833 8 Left 995473826 5:112528628-112528650 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG No data
995473827_995473833 5 Left 995473827 5:112528631-112528653 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG No data
995473825_995473833 9 Left 995473825 5:112528627-112528649 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995473833 Original CRISPR AAGGTCCTGTTAAACTCTGG GGG Intergenic
No off target data available for this crispr