ID: 995473976

View in Genome Browser
Species Human (GRCh38)
Location 5:112529815-112529837
Sequence CCAGTTCACCCGTTCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995473971_995473976 -5 Left 995473971 5:112529797-112529819 CCCATCAGCTTACTCTCCCCAGT No data
Right 995473976 5:112529815-112529837 CCAGTTCACCCGTTCTCTCCAGG No data
995473972_995473976 -6 Left 995473972 5:112529798-112529820 CCATCAGCTTACTCTCCCCAGTT No data
Right 995473976 5:112529815-112529837 CCAGTTCACCCGTTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995473976 Original CRISPR CCAGTTCACCCGTTCTCTCC AGG Intergenic
No off target data available for this crispr