ID: 995474955

View in Genome Browser
Species Human (GRCh38)
Location 5:112538796-112538818
Sequence GAGGGTGAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995474945_995474955 24 Left 995474945 5:112538749-112538771 CCAAGCTCATCTCACTGGGACTG 0: 53
1: 268
2: 806
3: 1033
4: 1193
Right 995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995474955 Original CRISPR GAGGGTGAACAGAAGCAGGG TGG Intergenic
No off target data available for this crispr