ID: 995476714

View in Genome Browser
Species Human (GRCh38)
Location 5:112555441-112555463
Sequence CCTCATCTGCAAAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995476709_995476714 12 Left 995476709 5:112555406-112555428 CCTGGTCTCTCGGTGAGATCTCA No data
Right 995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995476714 Original CRISPR CCTCATCTGCAAAGGAAGGA GGG Intergenic
No off target data available for this crispr