ID: 995483628

View in Genome Browser
Species Human (GRCh38)
Location 5:112617019-112617041
Sequence AACAGCTGGGTGAAATTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995483621_995483628 -5 Left 995483621 5:112617001-112617023 CCCATGGAAGGCCCCAGGAACAG No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data
995483619_995483628 -1 Left 995483619 5:112616997-112617019 CCCACCCATGGAAGGCCCCAGGA No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data
995483620_995483628 -2 Left 995483620 5:112616998-112617020 CCACCCATGGAAGGCCCCAGGAA No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data
995483616_995483628 9 Left 995483616 5:112616987-112617009 CCTTGGCAGACCCACCCATGGAA No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data
995483615_995483628 10 Left 995483615 5:112616986-112617008 CCCTTGGCAGACCCACCCATGGA No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data
995483622_995483628 -6 Left 995483622 5:112617002-112617024 CCATGGAAGGCCCCAGGAACAGC No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data
995483613_995483628 11 Left 995483613 5:112616985-112617007 CCCCTTGGCAGACCCACCCATGG No data
Right 995483628 5:112617019-112617041 AACAGCTGGGTGAAATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995483628 Original CRISPR AACAGCTGGGTGAAATTAAA TGG Intergenic
No off target data available for this crispr