ID: 995485740

View in Genome Browser
Species Human (GRCh38)
Location 5:112638303-112638325
Sequence AGGGGTACACAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995485733_995485740 1 Left 995485733 5:112638279-112638301 CCTTTTGGTTCAGGTAAACCTTC No data
Right 995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995485740 Original CRISPR AGGGGTACACAGAAGGATGG AGG Intergenic
No off target data available for this crispr