ID: 995491262

View in Genome Browser
Species Human (GRCh38)
Location 5:112693861-112693883
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995491262_995491266 22 Left 995491262 5:112693861-112693883 CCTGTCTCTTTCAGTTCAAGGTA No data
Right 995491266 5:112693906-112693928 CCCTCAAAGCTTCCTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995491262 Original CRISPR TACCTTGAACTGAAAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr