ID: 995491837

View in Genome Browser
Species Human (GRCh38)
Location 5:112701650-112701672
Sequence GAGGAGAAGGAAGTAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995491834_995491837 7 Left 995491834 5:112701620-112701642 CCTGCTACTGATATTTTAGTGGA No data
Right 995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995491837 Original CRISPR GAGGAGAAGGAAGTAAACAC TGG Intergenic
No off target data available for this crispr