ID: 995494683

View in Genome Browser
Species Human (GRCh38)
Location 5:112728425-112728447
Sequence ACATATAAAATACACTGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995494683_995494688 10 Left 995494683 5:112728425-112728447 CCCGACCAGTGTATTTTATATGT 0: 1
1: 0
2: 1
3: 38
4: 259
Right 995494688 5:112728458-112728480 AATTCTTCCAGTGTTGCTCAGGG No data
995494683_995494690 25 Left 995494683 5:112728425-112728447 CCCGACCAGTGTATTTTATATGT 0: 1
1: 0
2: 1
3: 38
4: 259
Right 995494690 5:112728473-112728495 GCTCAGGGAAGCCAAAATATTGG No data
995494683_995494687 9 Left 995494683 5:112728425-112728447 CCCGACCAGTGTATTTTATATGT 0: 1
1: 0
2: 1
3: 38
4: 259
Right 995494687 5:112728457-112728479 CAATTCTTCCAGTGTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995494683 Original CRISPR ACATATAAAATACACTGGTC GGG (reversed) Intronic
903820368 1:26097588-26097610 TCACATATAATACAGTGGTCTGG + Intergenic
903978411 1:27167265-27167287 AAAAAAAAAATAGACTGGTCAGG - Intergenic
904106920 1:28092623-28092645 ATATATGAAGTACAATGGTCTGG + Intergenic
906954053 1:50358046-50358068 AGATATAAACTAGACAGGTCAGG - Intergenic
906973546 1:50544758-50544780 TAATATAAAATAGAGTGGTCAGG + Intronic
907708801 1:56858023-56858045 AAATTTAAAATTCACTGGACAGG - Intronic
907752362 1:57274415-57274437 ACTTATATAAGACACTCGTCTGG - Intronic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
909764890 1:79342932-79342954 ACATATAAAATACCTTAGTTAGG - Intergenic
910690204 1:89957975-89957997 ACATATAAAGAACTCTGGCCCGG + Intergenic
913563926 1:120051825-120051847 ACTTATAAAATACACTGTTGTGG + Intronic
913634199 1:120741740-120741762 ACTTATAAAATACACTGTTGTGG - Intergenic
914141645 1:144954567-144954589 ACATATCATATACAATGGTTGGG + Intronic
914284517 1:146211175-146211197 ACTTATAAAATACACTGTTGTGG + Intronic
914330112 1:146660906-146660928 ATATATAATATACACTGGTTGGG - Intergenic
914545548 1:148661914-148661936 ACTTATAAAATACACTGTTGTGG + Intronic
914621017 1:149408753-149408775 ACTTATAAAATACACTGTTGTGG - Intergenic
916037126 1:160932344-160932366 ACATAGAAAATTCACTGATATGG - Intergenic
916565644 1:165974478-165974500 ACATACAAAATACCTTGCTCAGG + Intergenic
918033274 1:180838673-180838695 ACATTTAAAATACACTGAAACGG - Intronic
918838781 1:189505911-189505933 AAATCTCAAATACATTGGTCTGG - Intergenic
920169379 1:204061221-204061243 ACAAACAAAATACAGTGGACTGG - Intergenic
920359916 1:205407624-205407646 TCCTTTAAAATACACTGGTAAGG + Intronic
921480467 1:215659101-215659123 ACAAATAAAATAAACAGGTTAGG + Intronic
921850821 1:219930174-219930196 ACAAAAAAAAAACACAGGTCAGG + Intronic
922115817 1:222613108-222613130 AGATAAAAAATACACTGGATAGG - Intergenic
923359903 1:233200719-233200741 ACATAAAAAAAACACAGGACAGG + Intronic
924145041 1:241065009-241065031 ACATTTAAAATACAATGATGAGG - Intronic
1063166018 10:3463158-3463180 ATATATAAGATGCACTGGTTAGG + Intergenic
1063290324 10:4739166-4739188 ACATATAAAAAACATTAGCCAGG - Intergenic
1065847740 10:29760361-29760383 ACATTTAAAATAAGCAGGTCAGG - Intergenic
1066276301 10:33871851-33871873 ACATATAAAATAAACTGTGCTGG + Intergenic
1067680647 10:48436334-48436356 ACAGTTAACATACACTTGTCAGG - Exonic
1067975765 10:51023342-51023364 ACATATAAAAGACAGTGTTCAGG - Intronic
1068317745 10:55368819-55368841 ATATAAAAAATACACTTGTATGG - Intronic
1068926012 10:62539490-62539512 AAAAATAAAATAAAATGGTCAGG + Intronic
1069282144 10:66668515-66668537 ATATATAAAATATATTGGCCGGG + Intronic
1069381413 10:67846273-67846295 ACTTAAAAAAGACACTGGTTAGG - Intergenic
1070914786 10:80145914-80145936 ACATTTTAAATACAGTAGTCCGG + Intergenic
1071526150 10:86360318-86360340 ATGTATAAAATACAGTGGTGGGG + Intronic
1072141054 10:92589546-92589568 ACATATAAAGTACACTGGCTGGG - Intergenic
1074225136 10:111477398-111477420 CAACATAAAATACAGTGGTCAGG + Intergenic
1075691199 10:124395622-124395644 ACATCCAAAATACTCTGTTCAGG + Intergenic
1077087592 11:762262-762284 ACATATAAAAACAAATGGTCCGG - Intronic
1078045221 11:7907725-7907747 ACAACTAAAAAACAATGGTCAGG - Intergenic
1079376159 11:19893861-19893883 ACTTAAAAAACACACTGGTACGG - Intronic
1079435637 11:20445768-20445790 AAATATAAACTACACTGTTTAGG - Intronic
1079499313 11:21084824-21084846 ACATTAAAAATACACTGTCCAGG + Intronic
1080421482 11:32115007-32115029 ACATACAAAAAACACTTTTCTGG + Intergenic
1085875523 11:80402715-80402737 ACATATAAAAAACATGGGTTGGG - Intergenic
1086750201 11:90483816-90483838 AAATATAAAATACAATCATCTGG - Intergenic
1087437365 11:98138500-98138522 ACTTAAAAAATACAGTTGTCAGG + Intergenic
1087574952 11:99977835-99977857 ACATAACAAATACACTAGTCAGG + Intronic
1089706285 11:120280293-120280315 AAATATAAAATCTACTGCTCTGG - Intronic
1089876360 11:121725413-121725435 AGATATAAAATACACTTATGAGG - Intergenic
1090046334 11:123337857-123337879 CCATATAAAATACTCTTGACTGG + Intergenic
1090240494 11:125178127-125178149 ATATATAAAATACAGTGGTTGGG - Intronic
1091610935 12:2008276-2008298 AAATATAAAAAACATTGGCCGGG - Intronic
1091938579 12:4453557-4453579 AGATGAAAAATACACTGGACAGG + Intergenic
1093376902 12:18440445-18440467 ACATAAAAAGTACAAGGGTCAGG + Intronic
1094027912 12:25978476-25978498 ACATCTAAAACACTCTGGACTGG - Intronic
1095435154 12:42179063-42179085 AAAGAAAAAATACACTTGTCTGG + Intronic
1096309863 12:50511272-50511294 AAATAGAAATCACACTGGTCAGG - Intronic
1098884981 12:75951879-75951901 ACATATTCAATTCACTGGTGGGG + Intergenic
1099543027 12:83938581-83938603 ACATATTAAATAAATTGTTCAGG + Intergenic
1099866376 12:88287483-88287505 ACTTTTAAAATATACTGGTCAGG - Intergenic
1100019027 12:90047460-90047482 ACATAAATAATACATTCGTCTGG - Intergenic
1102918935 12:116777280-116777302 ACATATAAAATATACAGAGCAGG + Intronic
1104257471 12:127152450-127152472 AGATAGAAAACAAACTGGTCTGG + Intergenic
1105976243 13:25475666-25475688 AAATATAACATACGCTGGTGAGG - Intronic
1106747303 13:32718901-32718923 ACTTAACAAATACATTGGTCAGG + Intronic
1107584452 13:41829822-41829844 ACATATCAGGTACACTGCTCAGG + Intronic
1108344683 13:49533899-49533921 ACATTTAAAATACACTTATCTGG + Exonic
1108924873 13:55729679-55729701 ACATCTAAAATCCAATTGTCTGG + Intergenic
1109898077 13:68720986-68721008 ACTAATAAAATATACTGGACTGG - Intergenic
1110114004 13:71788360-71788382 ACATATAAAAGCCACAGGTTTGG - Intronic
1110516954 13:76424936-76424958 ACATGAAAAATACACTGGCTAGG - Intergenic
1111281812 13:86036173-86036195 ACAAATCAAATATACTGGTTTGG + Intergenic
1113323547 13:109262213-109262235 ACATATAATATACAATGGAAAGG + Intergenic
1114306278 14:21425961-21425983 ACAGAAAAAAGACACTGGCCAGG + Intronic
1114679197 14:24470133-24470155 ACATATAATGTATAGTGGTCAGG - Intergenic
1116290539 14:43031196-43031218 CCATATAAAATACACTTCTTGGG + Intergenic
1117405643 14:55400605-55400627 ACAAATAAAATAAACTGGGCCGG + Intronic
1119815171 14:77559728-77559750 AAAAATAAAAAACACTAGTCCGG + Intronic
1121285637 14:92733508-92733530 ACATGTAAAATAAACTGTGCAGG + Intronic
1121947976 14:98141404-98141426 TCATATTAAATACCCTGATCAGG + Intergenic
1122360973 14:101163484-101163506 ATATATAAAATACAATGCTCTGG + Intergenic
1123680726 15:22761545-22761567 AAATATAAAATACAGTGGCCGGG + Intergenic
1124332935 15:28836003-28836025 AAATATAAAATACAGTGGCCGGG + Intergenic
1125490499 15:40145008-40145030 AAATAAAAAATAAACTAGTCAGG + Intergenic
1126247633 15:46527706-46527728 ACATCTAAAAAATACTGCTCAGG - Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127742733 15:61928586-61928608 ACATAGAAAAGTCACTGATCTGG + Intronic
1130410504 15:83644149-83644171 ACAATAAAAATACACTGCTCTGG + Intergenic
1130999804 15:88930853-88930875 ACACATAAAATCCACTGGAGGGG - Intergenic
1131089977 15:89616658-89616680 ATATAAAATATACACTTGTCTGG + Intronic
1131109195 15:89754108-89754130 ACATATAAAATACAGTAATGAGG + Intergenic
1132084028 15:98891834-98891856 AAATATAAAACAAACTGGTGAGG - Intronic
1136916100 16:34199421-34199443 ACATAAAAACTACACAGGGCCGG - Intergenic
1137635309 16:49980883-49980905 AAATATAAAAAACATTAGTCGGG + Intergenic
1138366281 16:56480398-56480420 AAAAATAAAAAATACTGGTCTGG - Intronic
1139770153 16:69268165-69268187 ACTTCTAAAATACAATGGGCCGG + Intronic
1144005627 17:11096502-11096524 ACATAAAATATTCACAGGTCTGG - Intergenic
1145126745 17:20307166-20307188 AAATATAAAATATAATGGTAAGG + Intronic
1145378429 17:22373226-22373248 ATATAAAAAATACACTAGGCTGG - Intergenic
1145745253 17:27314277-27314299 AATTTTAAAATACACTGGCCGGG + Intergenic
1146221716 17:31028999-31029021 ATCTAAAAAATACACTGGGCCGG - Intergenic
1146999986 17:37355260-37355282 ACATAAAAAATAAAGTGGCCAGG + Intronic
1149144415 17:53472982-53473004 ACATGTAAAATTAACTGGTTGGG - Intergenic
1149536013 17:57433850-57433872 TCATACAAAAAACACTGGTTAGG - Intronic
1150366122 17:64586867-64586889 ATCTAAAAAATACACTGGGCTGG + Intronic
1151721415 17:75858477-75858499 AGAAATAAAATACACAGGCCGGG + Intergenic
1152054328 17:78011152-78011174 ACACAGAAAAGAAACTGGTCTGG - Intronic
1155424182 18:25689019-25689041 ACATATTAAACACACTAGTGTGG - Intergenic
1156281712 18:35645523-35645545 ATATATAAAATAAACCGGCCAGG - Intronic
1157180673 18:45495329-45495351 ACAAACAAAATACAATGGCCGGG + Intronic
1157527202 18:48392980-48393002 ACATATAGAAGATACTGGCCAGG + Intronic
1158079494 18:53573193-53573215 ACATATAAAATATTCTGAACTGG - Intergenic
1161860958 19:6797980-6798002 ATATTTAAAATACATTGGTGGGG + Intronic
1165724969 19:38106400-38106422 AAAAATTAAATACACTGGCCAGG - Intronic
1166849819 19:45754270-45754292 ACCTTTAAAAAACACTGGCCAGG - Intronic
1167264348 19:48476135-48476157 AAATGTAAAATACACAAGTCAGG + Intronic
1167976492 19:53231024-53231046 ACATATAAATTACCCAGGTCAGG - Intergenic
1168080334 19:54005458-54005480 AAAAATAAAATAAACTGGCCGGG + Intronic
925824722 2:7836472-7836494 ATTTATAAAATCTACTGGTCAGG + Intergenic
926618007 2:15018352-15018374 ACATATAAGGTACAGTGATCAGG - Intergenic
927810563 2:26178288-26178310 ACATATAAGAGCCACTGCTCAGG - Intronic
928160138 2:28915524-28915546 ACATATAATAGACACTATTCAGG - Intronic
929038413 2:37719550-37719572 GGATACAAAATACACAGGTCAGG + Intronic
930966356 2:57333628-57333650 ACAAATAAGCTACACTGGTCAGG + Intergenic
931330751 2:61280243-61280265 ACATATAAAGGACGCTAGTCAGG - Exonic
932374429 2:71223063-71223085 AAATATAAAATCCACAGGGCAGG + Intronic
934071619 2:88389601-88389623 ACATATAAAAAACAGTGGCCGGG + Intergenic
936771050 2:115913973-115913995 ATATATAACATAAACTGTTCTGG + Intergenic
936925803 2:117735501-117735523 ACATATAATGTACACTGGACAGG + Intergenic
937448640 2:121981065-121981087 AAAAATATAATACAATGGTCAGG - Intergenic
939695756 2:145322089-145322111 ACATATAAAAAAAATGGGTCAGG - Intergenic
939938594 2:148322356-148322378 AAATGAAAAATACACAGGTCAGG - Intronic
941385942 2:164852003-164852025 AGAAATAAAAAACATTGGTCAGG - Intergenic
941562617 2:167067326-167067348 ACATGAAAAATACACTGGTTGGG - Intronic
941804954 2:169702638-169702660 ATCTTTAAAATACACTGGTTTGG - Intronic
941910305 2:170758045-170758067 ACATATAAAACACACAGGTCAGG + Intergenic
942479549 2:176369169-176369191 ACATGTAAATTAAACTTGTCAGG + Intergenic
942508381 2:176668761-176668783 ACAAAGAAAGAACACTGGTCTGG - Intergenic
942698910 2:178680819-178680841 ACATATAAAATAGAATGTTTGGG - Intronic
943000029 2:182315503-182315525 ACATGTAAAATAAACTGGTGTGG - Intronic
943177335 2:184493387-184493409 ACATATAATATATAGTGATCAGG + Intergenic
943346319 2:186741837-186741859 AAATATTAAATACAGTGGACAGG + Intronic
944576285 2:201094318-201094340 ATATTTTAAATACATTGGTCAGG + Intergenic
944964637 2:204916582-204916604 CCTTATAAAATACACTCTTCTGG - Intronic
945866337 2:215180628-215180650 AAGTATAAAACACACTGGGCAGG - Intergenic
946953238 2:224899832-224899854 ACTTAGAATATACACTGGTTTGG - Intronic
947271403 2:228340121-228340143 ACATGAAAAATACACTGGATAGG - Intergenic
1171524848 20:25800764-25800786 ATATAGAAAATACACTAGGCTGG + Intronic
1171551979 20:26055119-26055141 ATATAGAAAATACACTAGGCTGG - Intergenic
1171855361 20:30337987-30338009 ATATAGAAAATACACTAGGCTGG + Intergenic
1176358923 21:5976274-5976296 ACATAGAATATATACTGATCAGG + Intergenic
1177363812 21:20107588-20107610 ACCTATATAATACATTTGTCTGG - Intergenic
1177453130 21:21298411-21298433 AACTATAAAATACTCTGGTTTGG - Intronic
1177610975 21:23448194-23448216 ACATTTAAAAAATACTGTTCAGG + Intergenic
1179764595 21:43562276-43562298 ACATAGAATATATACTGATCAGG - Intronic
1180989274 22:19924628-19924650 AGATGAAAAATACACTGGACGGG + Intronic
1182498018 22:30724376-30724398 AAATATAAAATAAACTAGCCGGG - Intronic
1182758976 22:32706748-32706770 ACATATGAAAGAGACTGGTCAGG - Intronic
1183809086 22:40238774-40238796 ATGTATAAAATACACAGTTCAGG - Intronic
1184048170 22:41985156-41985178 ACATTTGAAAACCACTGGTCAGG - Intronic
1184625373 22:45723474-45723496 AGGTATAATATACACTGCTCAGG - Intronic
949108623 3:231088-231110 ACATATAAAATTCACCCTTCTGG - Intronic
949336789 3:2983551-2983573 ACATGTAAAATACACCAGGCGGG - Intronic
951229673 3:20162824-20162846 ACAGAAAAAATACACTGGATAGG + Intronic
951780581 3:26358568-26358590 AAATATAAAATAAGTTGGTCTGG - Intergenic
952800225 3:37283820-37283842 AAATATAAAATACACAGGACAGG - Intronic
953313513 3:41903721-41903743 ATATATAAAATAAAATGTTCAGG + Intronic
953915567 3:46918447-46918469 AAATAAAAAATACAGTAGTCTGG - Intergenic
955425143 3:58780273-58780295 ATATATAAAAAACACTGGTAGGG + Intronic
956295522 3:67709064-67709086 TCATATAATATACAGTGTTCTGG + Intergenic
957292627 3:78296497-78296519 ACAAATAAAAGACACCGGCCGGG + Intergenic
957960307 3:87241203-87241225 ACTTTTATAATAGACTGGTCTGG + Intronic
960805247 3:121577556-121577578 ACATGTAAAATATACTTTTCTGG - Intronic
961366584 3:126403364-126403386 AAAGATAAAATACACTCGACTGG - Intronic
963382604 3:144551037-144551059 ACATATAAGAAACACTTTTCTGG + Intergenic
964067054 3:152593064-152593086 ACATATCAAATATACTGTTTAGG + Intergenic
964206386 3:154179583-154179605 ACACATAAAATACACAGCCCAGG - Intronic
965222793 3:165949717-165949739 AAATATAACTTACACTGGGCAGG + Intergenic
965359472 3:167720255-167720277 ACACAAAAAACACACTGATCTGG + Exonic
965617568 3:170610808-170610830 AAATAAAAAATAAACTGGCCAGG - Intronic
969093676 4:4716564-4716586 ACATATAAAATAAAATGGGCTGG - Intergenic
969127459 4:4962935-4962957 AGATAAAAAATACACTGGATGGG - Intergenic
970264845 4:14270840-14270862 ACATATAAAATAAAAGGGTAAGG - Intergenic
970811386 4:20098701-20098723 ACATTTAAAATAGAGTGATCAGG + Intergenic
971954550 4:33399621-33399643 ACAAATAAAATACACTACTTAGG + Intergenic
972761243 4:42106506-42106528 ACACATAAAATACACTAATGAGG - Intergenic
976115759 4:81724067-81724089 ACAAACAGAACACACTGGTCTGG + Intronic
977051640 4:92135657-92135679 AAATATAACAAACACTGGTAAGG + Intergenic
977086762 4:92609485-92609507 CCATTTAAAATAAAGTGGTCAGG + Intronic
978793028 4:112682170-112682192 ACAAACAAAATACACTAGCCAGG - Intergenic
979399794 4:120234707-120234729 TCATATAAAATAATATGGTCTGG - Intergenic
979485690 4:121267382-121267404 ACTTAGAAAATACATTGCTCTGG - Intergenic
979550742 4:121988366-121988388 ACATATTGGATACACAGGTCTGG + Intergenic
980737531 4:136910868-136910890 ACATATAAAATCCTCTCCTCTGG + Intergenic
982879435 4:160693002-160693024 ACATAAAAAATATCCTGTTCTGG - Intergenic
983989013 4:174095580-174095602 ACATATATATTTTACTGGTCAGG - Intergenic
984045677 4:174795480-174795502 ACATGAAATATACATTGGTCTGG + Intronic
984397896 4:179224292-179224314 ACATTTATAAAACACTGGTCTGG - Intergenic
986168995 5:5300468-5300490 ACATAAAAAATACACATGTCAGG - Intronic
986391718 5:7293516-7293538 AAATATAAAATACAGTGGCCGGG + Intergenic
986880965 5:12170929-12170951 ACATTTAAAATACACTTTTAGGG + Intergenic
986951609 5:13093318-13093340 AAATATAACAAACACTGGTTGGG + Intergenic
987030995 5:13976903-13976925 TCACATAAAATATATTGGTCTGG + Intergenic
987835600 5:23156848-23156870 ACATAAAACATCCACTGTTCAGG - Intergenic
990365133 5:55062786-55062808 ACATTTAAAATACTCTAGGCTGG + Intergenic
992953308 5:81882152-81882174 ACATAAGAAATACACTGGCTTGG + Intergenic
993424444 5:87745689-87745711 AATTATAAAATACACTTTTCAGG - Intergenic
993921903 5:93815464-93815486 ACATGTAAGATACTCTGGACTGG - Intronic
994071325 5:95606012-95606034 ACTAATAAAATAGACTGGTCTGG - Intergenic
994845181 5:104979795-104979817 ACTTCTAAAATACAATGGTGGGG + Intergenic
995494683 5:112728425-112728447 ACATATAAAATACACTGGTCGGG - Intronic
996628483 5:125599422-125599444 TCATAGCAAATGCACTGGTCAGG - Intergenic
997816695 5:137026235-137026257 ACACATAAAATTAACTGCTCTGG - Intronic
1000222937 5:159231659-159231681 ACATTTAAAATACAGAGGACAGG - Intergenic
1001319291 5:170667153-170667175 AAATATAAAATAAGCTGGGCGGG + Intronic
1001754182 5:174155113-174155135 AAATCTAAAATACACTTGTTAGG - Intronic
1003710403 6:8583170-8583192 ACATTTAAAAGTCACTGTTCTGG - Intergenic
1003986382 6:11439636-11439658 AAAGATAAAATAGACTGGTGTGG - Intergenic
1006207733 6:32363820-32363842 AAGTATAAAATTCACTGGTAAGG - Intronic
1007403857 6:41621337-41621359 AAATAAAAAATACACTGGAGTGG - Intergenic
1008508280 6:52252470-52252492 ACATAAAAAATAATATGGTCAGG + Intergenic
1008751876 6:54744722-54744744 AAGTATAAAATTCACTGGTGAGG - Intergenic
1011776210 6:90733484-90733506 ACATATAATGTACAGTGATCTGG + Intergenic
1012124067 6:95405095-95405117 ACATAGAAAATACACTTTTTTGG - Intergenic
1012951272 6:105520455-105520477 AGAAATAAAATCCACTGTTCAGG + Intergenic
1013153597 6:107471365-107471387 ACATATAAAAGACAATTGGCTGG + Intergenic
1014356947 6:120424106-120424128 ACAAATAAAAAACAGTGGTTTGG + Intergenic
1014587928 6:123223882-123223904 ACATATTAAAAACACTAGTTGGG - Intronic
1014671976 6:124315648-124315670 AGATATAAATTACACTGCACTGG + Intronic
1016641135 6:146350919-146350941 ACATATAAAATACCCAGGCTAGG - Intronic
1017555362 6:155559688-155559710 AGATATAAAATATATTGGTAAGG - Intergenic
1017611296 6:156189038-156189060 ACATAGAAAATAGAGTGGTATGG - Intergenic
1020356688 7:7283880-7283902 AAATATAAAATTCACTGGTAAGG + Intergenic
1021350723 7:19590647-19590669 AAAAATAAAAGACACTGGTGAGG - Intergenic
1022110939 7:27231126-27231148 ACATTAACAATACATTGGTCAGG + Intergenic
1022452970 7:30533003-30533025 AAATATAAAATCCACGGGGCAGG + Intronic
1023065570 7:36374065-36374087 ATATATAAAATAAAATGGCCAGG - Intronic
1023548952 7:41348320-41348342 ATATTTAAAACACACTGGCCGGG + Intergenic
1024475360 7:49803158-49803180 ACACATTAAACACACTGGTTGGG + Intronic
1025244210 7:57303973-57303995 ATAAATAAAATAAACTGGCCTGG - Intergenic
1025934611 7:66025259-66025281 ACATATCAAAAACACTGTGCAGG - Intergenic
1028114136 7:86978441-86978463 AAATATAAGACACACTGGTTGGG + Intronic
1029586869 7:101478656-101478678 TCCTTTAAAATACACTGTTCTGG - Intronic
1029787525 7:102807616-102807638 ACAAATAAAAAACAGAGGTCAGG + Intronic
1030819558 7:114079422-114079444 ACATATAAAATATATTTGTCTGG + Intergenic
1031189969 7:118536372-118536394 ATATATAAATTAGGCTGGTCAGG + Intergenic
1032448650 7:132006924-132006946 ACATGTAAAATGCACAAGTCTGG - Intergenic
1032667724 7:134053689-134053711 ACATTTAAAATAAGGTGGTCAGG + Intronic
1033867594 7:145712013-145712035 ACAAATAACATACAATGGTCTGG - Intergenic
1034247746 7:149661740-149661762 AAATACAAAATACACTGGGAAGG - Intergenic
1035293098 7:157852573-157852595 CCTTAAAAAATACACTGGCCGGG + Intronic
1035453084 7:158991678-158991700 ACAAATAATATGCCCTGGTCTGG - Intergenic
1035962862 8:4157119-4157141 AAATATAAAATACACTCTTAGGG - Intronic
1037531824 8:19783746-19783768 TCAAAAAAAATACACTGGCCGGG + Intergenic
1037972985 8:23187629-23187651 ACCTATGAAATATACTGGCCAGG - Intergenic
1039529155 8:38244246-38244268 AAAAATAAAATATACTGTTCAGG - Intronic
1041205074 8:55491118-55491140 AAATAAAAAATACACTGGATTGG - Intronic
1042523442 8:69739190-69739212 CCATATAAAATACATTGTTTTGG - Intronic
1042833280 8:73054702-73054724 ACATAGAAACTACACAGCTCAGG - Intergenic
1043965764 8:86473468-86473490 ACATTTAAAGTAAACTGGCCAGG + Exonic
1045574105 8:103399922-103399944 AAAAATAAAATAAAATGGTCTGG + Exonic
1045739074 8:105333021-105333043 AAATACAAAATACACTGATCAGG - Intronic
1047119974 8:121891559-121891581 ACATATGAAATACCCAGGTATGG - Intergenic
1048849307 8:138629448-138629470 AAATATAAAATATACTGGGCCGG - Intronic
1051197516 9:14578840-14578862 ACATATAAAACTCACTGGTAGGG + Intergenic
1051523002 9:18011815-18011837 TCATGTAAAATACACTGGGCTGG - Intergenic
1053241913 9:36502776-36502798 ACATATAGACCATACTGGTCAGG + Intergenic
1054770175 9:69076056-69076078 ACATAGAAAATAAAATGTTCTGG + Intronic
1055747695 9:79468254-79468276 AAAAAAAAAAGACACTGGTCAGG + Intergenic
1055861540 9:80755998-80756020 ACAGATAAAATGCAATGGTGAGG + Intergenic
1056955663 9:91079110-91079132 AAAAAAAAAATACACTGGTTTGG - Intergenic
1057348533 9:94274774-94274796 ACTTAAGAAATACACTGGTTTGG + Intronic
1058892141 9:109370465-109370487 AAATAAAAAATAAACTGGTGTGG - Intergenic
1059854349 9:118379001-118379023 AGACATAAAATAGATTGGTCAGG - Intergenic
1059857598 9:118417405-118417427 ATATATAAAATATAGTGGTTTGG + Intergenic
1060493194 9:124099886-124099908 ACATAGACAATAGACTGGACTGG - Intergenic
1062620834 9:137421474-137421496 AAATAAAAAATACAATGATCAGG - Intronic
1186254570 X:7704301-7704323 ACATTTTAAATACACTGCCCAGG - Intergenic
1186560899 X:10612054-10612076 ACATATAAACTACATTGTTTTGG - Intronic
1187119073 X:16385785-16385807 TCATATAAAATGCAGTTGTCTGG - Intergenic
1190387991 X:49902021-49902043 TGATATAAAATACACTGGATGGG + Intergenic
1191644187 X:63462408-63462430 ACATATCAAATACAGAGCTCAGG + Intergenic
1195725243 X:107908500-107908522 AGATAAAAAATACACTGGAGGGG - Intronic
1195869599 X:109472342-109472364 ACATACAAAATACAGTGGAAAGG - Intronic
1196206354 X:112944413-112944435 AGAAATAAAATAGAGTGGTCGGG - Intergenic
1196922606 X:120600204-120600226 AAAAGTAAAATACACTGGCCGGG + Intronic
1197539572 X:127740572-127740594 AAATATAAAAAACACTTTTCTGG + Intergenic
1201328894 Y:12797351-12797373 ATGTACAAAATACACTGGTTTGG + Intronic
1201692305 Y:16780308-16780330 AAAAATAAAATAGATTGGTCAGG - Intergenic
1202166144 Y:21990778-21990800 CCATATAAAATACATTAGGCAGG + Intergenic
1202225214 Y:22595595-22595617 CCATATAAAATACATTAGGCAGG - Intergenic
1202317900 Y:23600066-23600088 CCATATAAAATACATTAGGCAGG + Intergenic
1202552866 Y:26069992-26070014 CCATATAAAATACATTAGGCAGG - Intergenic