ID: 995495656

View in Genome Browser
Species Human (GRCh38)
Location 5:112739333-112739355
Sequence GTGGCTTTGTAAAGCCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 134}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995495646_995495656 10 Left 995495646 5:112739300-112739322 CCACACCTCCCCACTCCCTGAAC 0: 1
1: 0
2: 12
3: 85
4: 847
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495651_995495656 1 Left 995495651 5:112739309-112739331 CCCACTCCCTGAACAAGGATGGC 0: 1
1: 0
2: 1
3: 13
4: 120
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495655_995495656 -6 Left 995495655 5:112739316-112739338 CCTGAACAAGGATGGCAGTGGCT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495652_995495656 0 Left 995495652 5:112739310-112739332 CCACTCCCTGAACAAGGATGGCA 0: 1
1: 0
2: 2
3: 16
4: 184
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495648_995495656 5 Left 995495648 5:112739305-112739327 CCTCCCCACTCCCTGAACAAGGA 0: 1
1: 0
2: 0
3: 25
4: 304
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495654_995495656 -5 Left 995495654 5:112739315-112739337 CCCTGAACAAGGATGGCAGTGGC 0: 1
1: 0
2: 0
3: 14
4: 218
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495645_995495656 14 Left 995495645 5:112739296-112739318 CCTGCCACACCTCCCCACTCCCT 0: 1
1: 0
2: 12
3: 162
4: 1438
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495649_995495656 2 Left 995495649 5:112739308-112739330 CCCCACTCCCTGAACAAGGATGG 0: 1
1: 0
2: 1
3: 18
4: 184
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134
995495644_995495656 18 Left 995495644 5:112739292-112739314 CCAGCCTGCCACACCTCCCCACT 0: 1
1: 0
2: 3
3: 81
4: 724
Right 995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995495656 Original CRISPR GTGGCTTTGTAAAGCCCTCC AGG Intronic
901436455 1:9249986-9250008 GTGGCCTGGTACAGCCCTGCTGG + Intronic
905219299 1:36433250-36433272 GTGGCCTTATATAGCCCTCGAGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906732375 1:48094030-48094052 GTGTTTTTATAAAGCCCTACAGG + Intergenic
907272150 1:53297470-53297492 GTGGCTTTGTACTGCCCAGCGGG + Intronic
913535572 1:119768918-119768940 GGGGCTTTATAAAGTCCTGCCGG - Intergenic
915558176 1:156671285-156671307 CTGGCTCAGGAAAGCCCTCCTGG - Exonic
916430084 1:164719591-164719613 GTAGTTTTGGAAAGCTCTCCAGG + Intronic
917707583 1:177649741-177649763 GTGGCTCTGCAAAACACTCCAGG + Intergenic
920055855 1:203191026-203191048 GAGGCTTTGTAAAGCCCCTAGGG + Intergenic
920056098 1:203192961-203192983 GAGGCTTTGTAAAGCCCTTAGGG + Intergenic
921756077 1:218857083-218857105 GTGGCATTGTAGAACCCTCTTGG + Intergenic
922068007 1:222162825-222162847 CTGCATTTTTAAAGCCCTCCAGG + Intergenic
1062905137 10:1174710-1174732 GTGGCTTTCTGAAACCCTCCAGG + Intergenic
1063951487 10:11227197-11227219 GTTCCTTTCTAAAGGCCTCCAGG - Intronic
1065131663 10:22627652-22627674 GTGGCTTTGTACAAACCTGCTGG + Intronic
1069742229 10:70692134-70692156 GTAGTTTTGTAAATTCCTCCAGG + Intronic
1075472029 10:122698269-122698291 GTGGCATTTTAAATGCCTCCAGG + Exonic
1075678339 10:124313437-124313459 TTTGATTTGCAAAGCCCTCCTGG - Intergenic
1076535803 10:131176062-131176084 GTCGCTTCGTCGAGCCCTCCGGG + Intronic
1076536675 10:131182383-131182405 GTTGCTTACTAATGCCCTCCCGG - Intronic
1077047778 11:553951-553973 CTTGCTTTCTAGAGCCCTCCGGG + Exonic
1077362957 11:2148891-2148913 GTGGCTTTGTGCAGCCCTAAAGG + Intronic
1079347376 11:19664724-19664746 CTGGTATTGTAAAGCCCTCAAGG - Intronic
1079368378 11:19829224-19829246 GTGGCTGAGGAAATCCCTCCAGG + Intronic
1080099782 11:28446303-28446325 GTCTATTTTTAAAGCCCTCCAGG + Intergenic
1081262167 11:40973960-40973982 ATGGCCTTGTGGAGCCCTCCAGG - Intronic
1083694741 11:64435167-64435189 GTGTCTTTAACAAGCCCTCCAGG - Intergenic
1085512422 11:77095158-77095180 GTGGCTCTCGAAAGCCCTCCTGG - Intronic
1088740068 11:112760087-112760109 ATGTATTTTTAAAGCCCTCCAGG - Intergenic
1089561764 11:119346723-119346745 GTGCCTTTGTGAATTCCTCCTGG - Intergenic
1093586770 12:20847086-20847108 GAGGCTTTCTAAATACCTCCAGG - Intronic
1098443671 12:70544602-70544624 GTGGCTTTGTGAATTCCTTCAGG + Exonic
1099300861 12:80892776-80892798 GGGGCTTTTTAAAGCCCTTCAGG + Intronic
1100625387 12:96326147-96326169 GTTGCTCTGTAAAGCTGTCCTGG + Intronic
1102778609 12:115543253-115543275 GGGGCTTTGTAAAGCCAGCCTGG - Intergenic
1102878675 12:116467413-116467435 GTTGCTTTGCACGGCCCTCCAGG + Intergenic
1103554166 12:121755923-121755945 GTGGCTTGATAAAGCCCCCCAGG + Intronic
1104607273 12:130199314-130199336 GTGGCTTTGAAAATCCCTTCAGG - Intergenic
1105950526 13:25225652-25225674 GTGGCTGTGCAGAGCCCTCCTGG + Intergenic
1108579481 13:51816596-51816618 GTGGCTTTTTAAATGCCTTCAGG + Intergenic
1112455466 13:99557790-99557812 ATGGCTTACTGAAGCCCTCCTGG - Intronic
1120601618 14:86517347-86517369 GTGGTTATGTAAATTCCTCCAGG + Intergenic
1120768375 14:88352803-88352825 GTGGCTTGGTACAGTCCTCACGG + Intergenic
1121559584 14:94864686-94864708 GTGGAGCTGTAAAGCCCTCTGGG + Intergenic
1121644073 14:95505939-95505961 GTAGCTTTTTAAAGCTCCCCAGG - Intergenic
1122244149 14:100389732-100389754 GTAGGTTTCTAAAGCCCTTCTGG - Intronic
1123117176 14:105899989-105900011 GTGGCCCTGGAAAGACCTCCAGG - Intergenic
1124384456 15:29195003-29195025 GTGGCCTTTCACAGCCCTCCTGG - Intronic
1130056091 15:80527275-80527297 GTGGCTTTGCAATGACCTGCAGG - Intronic
1133500488 16:6361685-6361707 GGGGGTTTGTAAAGCTCTCCAGG - Intronic
1134120016 16:11577190-11577212 TTGGCTTTCTCAAGCCCTCGTGG - Intronic
1134435686 16:14254240-14254262 GTGGCTAAGTAAGGCCCTACCGG + Intronic
1138491077 16:57377086-57377108 GTGGCTCTTTAAAGCCCTGGAGG + Intronic
1140677842 16:77351075-77351097 GTTGCTTTGGAAATCCCTCCTGG + Intronic
1141304757 16:82851754-82851776 ATGCCTTTGTAAACCCTTCCAGG + Intronic
1143327795 17:6110821-6110843 GTGGCTTTGTCAAGCTTCCCAGG + Exonic
1147469848 17:40648678-40648700 GTCTCTTTGTGATGCCCTCCTGG + Intergenic
1147904255 17:43812829-43812851 GTGGCTCCCTGAAGCCCTCCAGG + Intronic
1149655339 17:58306859-58306881 GTGGCTGTGGACAGCCCTGCTGG - Exonic
1152781258 17:82228373-82228395 GTGGCTTTGTAGGGCCCCGCAGG + Intergenic
1155435993 18:25813581-25813603 GTGGCTTGGGAGAGCCCACCAGG - Intergenic
1155824163 18:30418167-30418189 GTGAGTTTTTAAAGCTCTCCAGG + Intergenic
1158393624 18:57063141-57063163 GTGTCTTTGAAAAGGCCTCAGGG + Intergenic
1158920513 18:62186961-62186983 GTGGCTTAGGAATACCCTCCCGG - Exonic
1159108944 18:64034015-64034037 GAGGGTTGTTAAAGCCCTCCAGG - Intergenic
1162476849 19:10905464-10905486 GTGGGTTGGTTAAGCCCTTCTGG - Intronic
1164388380 19:27795395-27795417 CTGGGTTTGTAGAGTCCTCCAGG + Intergenic
1168084271 19:54033956-54033978 GTGGCTTTGTAAATAACTTCAGG - Intergenic
1168233504 19:55047693-55047715 CTGGGTTTATGAAGCCCTCCAGG - Intronic
925048957 2:796349-796371 GTGGCTGTGCAAAGTCTTCCAGG - Intergenic
926277517 2:11415904-11415926 GTTGCTTTATAAAGCCTCCCTGG + Intergenic
929556109 2:42926680-42926702 TTGCCTTTCTAAAGCGCTCCAGG - Intergenic
929817430 2:45245314-45245336 GTGGTTTTGTGAAACCCTTCTGG - Intergenic
930632684 2:53771120-53771142 ATGTCTTTGTCAAGCCCTCTAGG + Intronic
932594234 2:73084176-73084198 CTGGCTCTGTAAAGCCTGCCAGG - Intronic
932852127 2:75198135-75198157 GGGGCTTTGTAAATTCCTCCAGG - Intronic
934677371 2:96259170-96259192 GGGGCCTTGTATACCCCTCCTGG + Intronic
936117014 2:109710653-109710675 ATGGCTTTGGAGAGCCTTCCAGG + Intergenic
937927337 2:127177251-127177273 TTGGCTTTGGCAAGCACTCCAGG - Intergenic
938600175 2:132829670-132829692 CTGACTTTTTCAAGCCCTCCAGG - Intronic
939203761 2:139073516-139073538 GTGGGTTTGTCAAGCCCTAAGGG - Intergenic
940812120 2:158256790-158256812 GTGGGTTAGGAAAGCCTTCCTGG - Intronic
941615198 2:167710942-167710964 GGCCCTGTGTAAAGCCCTCCAGG + Intergenic
945908587 2:215621082-215621104 TTGGCTTTGTATGGCCCTTCTGG - Intergenic
946239063 2:218343017-218343039 GTAGCTGAGTAAAGCCCTGCAGG + Intronic
948819232 2:240530154-240530176 GTTGTTTTGTGAGGCCCTCCTGG - Intronic
1172318993 20:33981478-33981500 GGGTCTTTGTCAAGTCCTCCAGG - Intergenic
1176098527 20:63354684-63354706 GTGCCTGTGCACAGCCCTCCAGG - Intronic
1176378566 21:6100311-6100333 GCTGCTTTCTAAAGCCCTCCAGG + Intergenic
1177144603 21:17393716-17393738 TTGACTTTGTGCAGCCCTCCAGG + Intergenic
1179744909 21:43437926-43437948 GCTGCTTTCTAAAGCCCTCCAGG - Intergenic
1183237513 22:36630633-36630655 TTCGCTTTGTAAAGGCCTTCAGG - Intronic
1184462879 22:44649241-44649263 GAGGCTTTCCAAAGCCCTTCTGG - Intergenic
1184634878 22:45819500-45819522 GTGGCTTGGTAAAGCCACCTGGG - Intronic
955715821 3:61828719-61828741 TTGGCTTGGTGAAGACCTCCAGG + Intronic
956172635 3:66444553-66444575 GTGGCTTTGAGAACCACTCCTGG - Intronic
956716887 3:72087157-72087179 GTGTCTTTCTGAAGCCCACCTGG - Intergenic
956764833 3:72475723-72475745 GCGGCTTTGAAAAGCTCTCCAGG + Intergenic
959581986 3:107991873-107991895 GTATGTTTCTAAAGCCCTCCAGG - Intergenic
959636241 3:108574771-108574793 GTGTCTTTGGAAAGCCCCCAGGG + Intronic
960269819 3:115661434-115661456 TTTGCTTTGTCAAGCCCACCGGG + Intronic
960914767 3:122683948-122683970 TTGGTTTAGTAAAGCCCTTCAGG + Intronic
961582697 3:127895556-127895578 GTGACTTTGGGAAGCCCTGCAGG + Intergenic
963121140 3:141778093-141778115 CTGGCTATGTATAGCCCGCCAGG - Intergenic
963244123 3:143044565-143044587 AGGGCTTTGTAATGCCCTCAAGG + Intronic
963524691 3:146403349-146403371 TTTGCTTTATAAAGCCCTCCAGG - Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
972064156 4:34918713-34918735 GTGGCTTTTTAAATCCCACAAGG - Intergenic
980043708 4:127965896-127965918 CTGGCTCTGACAAGCCCTCCAGG - Exonic
982163224 4:152590844-152590866 GTGGCTTTATTAAACCCTGCTGG + Intergenic
984771202 4:183437644-183437666 CTGGCTTTCTAGATCCCTCCAGG + Intergenic
987365592 5:17146028-17146050 GTGGCTTTGTAAGCACCCCCTGG + Intronic
989199120 5:38746074-38746096 GGAGCTTTATAAAGCTCTCCAGG - Intergenic
992744604 5:79806777-79806799 GGGGTTTTATAAAGGCCTCCTGG + Intergenic
994049568 5:95347249-95347271 CTGGGTTGGGAAAGCCCTCCAGG + Intergenic
994306055 5:98205620-98205642 GGGGCTTTTTAAAGCTCCCCAGG + Intergenic
995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG + Intronic
1000025789 5:157358081-157358103 CAGGCTTTGTGAAACCCTCCAGG - Intronic
1001778067 5:174344036-174344058 CCGCCTTTGTAAAGCCCTGCCGG + Intergenic
1005578465 6:27211589-27211611 GTGCCTTTGGAAAGCCCGCAGGG + Intergenic
1007842085 6:44724949-44724971 GAGGCTTTGAAAGGCACTCCTGG + Intergenic
1007914285 6:45546585-45546607 GTGGGTTTTTAAAGCCCTCTGGG + Intronic
1010264950 6:73855813-73855835 TAGGCTTTGAGAAGCCCTCCAGG - Intergenic
1011727861 6:90229120-90229142 GGGAGTTTGTAAAGCTCTCCAGG - Intronic
1017147520 6:151248178-151248200 GTGTCTTTGAAAAGCTCTCTAGG - Intronic
1017345348 6:153373127-153373149 ATGACTTTCTAAAGCTCTCCTGG + Intergenic
1019285132 7:219558-219580 GTGGCTGTGCAGACCCCTCCTGG + Intronic
1020605274 7:10329391-10329413 GGGACTTTTTAAAGCCCTCCTGG + Intergenic
1020815963 7:12906684-12906706 GTAACTTTCTAAAGCTCTCCAGG + Intergenic
1021654893 7:22865155-22865177 CTGGCCCTGTAAAGGCCTCCTGG + Intergenic
1024553729 7:50584985-50585007 GTGGGTTTGCACAGCCCTCCAGG + Intergenic
1026842856 7:73680191-73680213 GTGGGTTTGTAAAGCACTAGTGG - Intergenic
1031884003 7:127226943-127226965 GTGGTTTTCTAAAGCAGTCCTGG + Intronic
1032054352 7:128672626-128672648 GTGGCCTTTTAAAGCCCTGGGGG + Intronic
1037666790 8:20976598-20976620 GATGCTTTGTAAAGCCTTCATGG - Intergenic
1039366548 8:36933982-36934004 GTGGATTTGTGAAGCAATCCTGG + Intronic
1042159543 8:65878305-65878327 GTGGTTTTGTAAAGAAATCCTGG + Intergenic
1047598915 8:126407165-126407187 GGGGCTTTCTAGAGCCCTGCAGG + Intergenic
1047801490 8:128314945-128314967 GTGGCTGTGTAAAGACCCCCTGG + Intergenic
1048340687 8:133536496-133536518 TTGGCATTGTAAAGGCCTCTGGG + Intronic
1055433306 9:76267065-76267087 GTGGCATTTCACAGCCCTCCAGG - Intronic
1056742080 9:89266174-89266196 GTGTCTTTAACAAGCCCTCCTGG - Intergenic
1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG + Intronic
1058669431 9:107348097-107348119 GAGGCTTTGTCAAGTCCTCATGG - Intergenic
1060103699 9:120860744-120860766 GAGGGTTAGTAAAGCCTTCCTGG + Intronic
1062027584 9:134347626-134347648 GTGGTTAGGGAAAGCCCTCCAGG + Intronic
1062568726 9:137174748-137174770 GTGGCTTTGTGGGGCCCCCCAGG - Intergenic
1189198622 X:39172944-39172966 GTGTGTTTGTAAAGTGCTCCAGG + Intergenic
1190784027 X:53626004-53626026 GTGGCTATGGAAAGCAGTCCAGG - Intronic
1192267175 X:69546889-69546911 GTGGCTTAGTACAGGCCTGCAGG + Intergenic
1195885217 X:109630464-109630486 GTGGCTCTGTAAGGCCATACTGG - Intronic
1198024564 X:132692609-132692631 GTGGCTTTGTAAAGGCCCAGAGG - Intronic
1201613971 Y:15875068-15875090 TTGGCTTTGTATAGACCTACGGG + Intergenic
1201616398 Y:15904712-15904734 TTGGCTTTGTATAGACCTACGGG - Intergenic