ID: 995506980

View in Genome Browser
Species Human (GRCh38)
Location 5:112870793-112870815
Sequence CTGTGTGATCCCATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2509
Summary {0: 1, 1: 37, 2: 129, 3: 658, 4: 1684}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995506980_995506983 3 Left 995506980 5:112870793-112870815 CCTTCCACCATGGGATCACACAG 0: 1
1: 37
2: 129
3: 658
4: 1684
Right 995506983 5:112870819-112870841 CAAAGACCCTTGCCATATACAGG 0: 1
1: 0
2: 3
3: 17
4: 113
995506980_995506987 17 Left 995506980 5:112870793-112870815 CCTTCCACCATGGGATCACACAG 0: 1
1: 37
2: 129
3: 658
4: 1684
Right 995506987 5:112870833-112870855 ATATACAGGTGCCATGCTTTTGG 0: 1
1: 0
2: 1
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995506980 Original CRISPR CTGTGTGATCCCATGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr