ID: 995508800

View in Genome Browser
Species Human (GRCh38)
Location 5:112887205-112887227
Sequence ATGGGTAACAGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995508790_995508800 16 Left 995508790 5:112887166-112887188 CCACAACAGGAAGCCACACTGCA 0: 1
1: 0
2: 2
3: 17
4: 203
Right 995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 416
995508791_995508800 3 Left 995508791 5:112887179-112887201 CCACACTGCACAGAAAAAGAGCC 0: 1
1: 0
2: 4
3: 19
4: 248
Right 995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 416
995508789_995508800 23 Left 995508789 5:112887159-112887181 CCATGCACCACAACAGGAAGCCA 0: 1
1: 0
2: 1
3: 17
4: 156
Right 995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995508800 Original CRISPR ATGGGTAACAGGAGGGTGGA GGG Intronic
900498757 1:2989418-2989440 ATGGATAACTGGATGGTGGATGG - Intergenic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
901216443 1:7558091-7558113 TTGGGTCACAGGAGGGTGGCTGG - Intronic
901262594 1:7885115-7885137 ATGGATGATAGGTGGGTGGATGG - Intergenic
901836399 1:11926464-11926486 ATGGAAAACGGGAGGGCGGAGGG + Intergenic
902107119 1:14047077-14047099 ATGGATGACAGGTGGATGGAAGG - Intergenic
902231266 1:15029193-15029215 ATGGTGAGGAGGAGGGTGGATGG + Intronic
902403853 1:16172544-16172566 AGGAGAAACAGTAGGGTGGAGGG - Intergenic
904426483 1:30426826-30426848 AGGGGTAACAAAAGGGTGGAAGG + Intergenic
905228240 1:36493849-36493871 ATGGATAAGTGGTGGGTGGACGG - Intergenic
905477953 1:38242149-38242171 ATGGGCACCCTGAGGGTGGAGGG - Intergenic
905773757 1:40654937-40654959 CTGGGCACCAGGAGGATGGAGGG - Intronic
907930008 1:58990537-58990559 ATGGGTGACATGGGGGTGGTGGG - Intergenic
909289516 1:73864610-73864632 GAGGGTGACAGGAGGGTGGAGGG + Intergenic
909337619 1:74493946-74493968 ATGGGTAACTGGAGTGGGAATGG + Intronic
910051769 1:82982805-82982827 TTTGGTAACAGGAGGATGCAAGG + Intergenic
910730724 1:90392937-90392959 TTGGGCAAGAGGAGAGTGGAGGG - Intergenic
910819734 1:91333455-91333477 AAGGGTAGTGGGAGGGTGGAGGG + Intronic
910842324 1:91572268-91572290 ATGGGTAAGAGGAGGGCGGTGGG + Intergenic
911099646 1:94084942-94084964 AGGGGAGACAGGAGGGAGGACGG - Intronic
912283611 1:108344464-108344486 GAGGGTAGGAGGAGGGTGGAGGG + Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916020767 1:160790328-160790350 ATGGGCAATAGGAGGGTGTTAGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916402682 1:164466168-164466190 TTGAGTAACAGGAGGAGGGAGGG - Intergenic
916577990 1:166084017-166084039 CAAGGTAACAGGAGGGTAGATGG + Intronic
917128743 1:171717438-171717460 AAGGGAAACAGGGAGGTGGATGG - Intronic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918210778 1:182349199-182349221 ATGGCAAAGAGGAGCGTGGAAGG + Intergenic
918928576 1:190821589-190821611 AAGGTTAGCTGGAGGGTGGAAGG + Intergenic
919861233 1:201740475-201740497 CTGGGGACCAGGCGGGTGGAAGG + Intronic
919881753 1:201905650-201905672 ATGGGTCACAGGAAGGAAGAAGG - Intronic
920799699 1:209174459-209174481 TTTGGTAGCAGGTGGGTGGAGGG + Intergenic
921264967 1:213414778-213414800 ATGGGTAACTGGAAGCAGGAGGG + Intergenic
921438627 1:215157510-215157532 ATGCATAACAAGAGAGTGGAAGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921875594 1:220191932-220191954 ATGGGTTACAGGACGATGGGAGG + Intronic
922066862 1:222152566-222152588 AGGGGTAAAAGGAGGGCAGATGG + Intergenic
922428029 1:225517746-225517768 ATGGGGAAGAACAGGGTGGAAGG + Intronic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
924434267 1:244024802-244024824 ATGTGTAACAGGTGTCTGGATGG - Intergenic
1062812591 10:477609-477631 ATGGGTGGGAGGAAGGTGGATGG + Intronic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064563180 10:16612883-16612905 AGGGGGAAGAGGAGGGGGGAAGG - Intronic
1064817963 10:19288430-19288452 AAGGGTAGCAGGAGGCTGGGAGG - Intronic
1065169832 10:23015725-23015747 ATGGGTAAAAAGAGGGTAGTGGG - Intronic
1067491393 10:46707385-46707407 AAAGGAAACAGGAGGGTGGAGGG - Intergenic
1067603271 10:47632993-47633015 AAAGGAAACAGGAGGGTGGAGGG + Intergenic
1067833514 10:49623799-49623821 ATGGGTTACATGAAGGTGCAAGG - Intronic
1068332954 10:55596949-55596971 AAAGGAAACAGGAGGGTGGAGGG + Intronic
1069448778 10:68499103-68499125 ATGGGAAAAAGGAGGGTTGGGGG + Intronic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1072248748 10:93565586-93565608 GTGGGTGGCAGGAGGGTGGCTGG + Intergenic
1072785882 10:98282052-98282074 ATGGGTCAAGGGAGGCTGGATGG - Intergenic
1073073339 10:100808551-100808573 ATGGCTAACAGAAGGGTAGGAGG - Intronic
1073698841 10:105902030-105902052 ATGGGGAACCGAAGGGTGCAAGG - Intergenic
1075962426 10:126580880-126580902 ATGGGTAGAGGGAGGGAGGATGG - Intronic
1076713240 10:132350584-132350606 ACGGGGAAGATGAGGGTGGAAGG + Intronic
1076729175 10:132429732-132429754 ATGGGCCACAGGAGGAAGGAAGG - Intergenic
1076845004 10:133065654-133065676 ATGGATAGATGGAGGGTGGATGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077781640 11:5336450-5336472 CTGGGAAACAGGAGGATTGATGG - Intronic
1078426991 11:11260046-11260068 ATGGGAAAGATGGGGGTGGAAGG - Intergenic
1078549756 11:12272034-12272056 CTGGGCTCCAGGAGGGTGGAGGG - Intergenic
1079035361 11:17015070-17015092 ATGTGAAACAGGAGGGAGCAGGG + Intergenic
1079552975 11:21723874-21723896 ATGTATCACAGGAGGGTGGCAGG - Intergenic
1081630678 11:44687523-44687545 ATGGTTAACATGAGGGTCAAGGG - Intergenic
1081892379 11:46554295-46554317 TTGAGTAACAGGAGGTCGGAAGG - Intronic
1083149405 11:60782494-60782516 AAGGGTATCAGGGGGGTGGGGGG + Intergenic
1083194151 11:61072964-61072986 ATGGGGAGCATGAGGGTCGATGG - Intergenic
1083229375 11:61306138-61306160 ACAGGGATCAGGAGGGTGGAGGG - Intronic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083369475 11:62166836-62166858 ATGGGAAACAGGAGGCAGGAGGG + Intergenic
1084445075 11:69198904-69198926 ATGGATAATAGGTGGATGGAAGG - Intergenic
1084457113 11:69274245-69274267 CTGGGCACCAGGTGGGTGGATGG + Intergenic
1084596392 11:70119302-70119324 ATGGGTGATGGGTGGGTGGATGG + Intronic
1084616806 11:70241891-70241913 ATGGAGGACAGGTGGGTGGATGG - Intergenic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1085260645 11:75202863-75202885 ATGGGCAACATGAGGTTGGAGGG - Intronic
1085375677 11:76058759-76058781 ATGGGCAACAGGAAGGTCAAAGG + Intronic
1086165711 11:83775325-83775347 ATGAGAAACAGGATGGTGCACGG + Intronic
1086472084 11:87124792-87124814 AGGGGAAAAAGGAGGGAGGAAGG - Intronic
1087455631 11:98382842-98382864 CTGGATACCAGCAGGGTGGAAGG + Intergenic
1087762138 11:102111814-102111836 AGGGGAAACGGGAGGGGGGAAGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088775780 11:113081296-113081318 CTGGCTAACTGGAGGATGGAAGG - Intronic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1090481597 11:127073801-127073823 ATGGGAAACCACAGGGTGGATGG + Intergenic
1091058196 11:132438561-132438583 GTGGGCAGCAGGAAGGTGGAAGG + Intronic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1092125782 12:6074133-6074155 ATGGGGAAAAGGAGGAGGGATGG - Intronic
1094857968 12:34425621-34425643 TTGGGTGGGAGGAGGGTGGAGGG - Intergenic
1095726996 12:45464804-45464826 GTAAGTAAAAGGAGGGTGGATGG - Intergenic
1096844980 12:54401491-54401513 GTGGTTTAGAGGAGGGTGGAAGG + Intronic
1098403591 12:70100010-70100032 ATTAGTAAATGGAGGGTGGATGG - Intergenic
1098455415 12:70667463-70667485 ATGGGTAACCAGGGGGTTGATGG - Intronic
1100682887 12:96948219-96948241 AAGTGTAACAGGAGGGCTGAGGG - Intronic
1102452769 12:113053986-113054008 ATGGATAAGTGGATGGTGGATGG + Intergenic
1102640254 12:114360735-114360757 ATGGGTGAATGGTGGGTGGATGG + Intronic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1104211974 12:126697642-126697664 ATTGTTGACAGTAGGGTGGAAGG - Intergenic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104919828 12:132285035-132285057 ATGGGGATCAGGAGGCTGGCAGG - Intronic
1105604016 13:21911951-21911973 AGGGGGCACAGGAGGGTGGGCGG - Intergenic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1106357135 13:28994043-28994065 GTGGGTGGCAGGAGGGGGGAGGG - Intronic
1107435778 13:40379719-40379741 TTGGGAAAGAGAAGGGTGGATGG - Intergenic
1108162332 13:47653999-47654021 AAGGGTTACTTGAGGGTGGAAGG - Intergenic
1108756122 13:53504495-53504517 TTGGGTAACAGGACAGTGAAAGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1111073408 13:83200055-83200077 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
1111445051 13:88336337-88336359 ATGTGTTACAGGATGATGGAGGG + Intergenic
1111687877 13:91523555-91523577 ATGGTTACCAGGAGCATGGATGG + Intronic
1112429356 13:99336935-99336957 AGGGGTCACAGGAGGGAGGTGGG - Intronic
1113901107 13:113798616-113798638 ATGGATGACAGATGGGTGGATGG + Intronic
1113901132 13:113798738-113798760 ATGGATGACAGATGGGTGGATGG + Intronic
1113934222 13:113984910-113984932 ATGGGTGACTGATGGGTGGATGG - Intronic
1113934533 13:113986744-113986766 ATGGGTGAGAGATGGGTGGATGG - Intronic
1113934904 13:113988845-113988867 ATGGGTGACTGATGGGTGGATGG - Intronic
1113934986 13:113989233-113989255 ATGGGTGAGAGATGGGTGGATGG - Intronic
1113935028 13:113989417-113989439 ATGGGTGAGAGATGGGTGGATGG - Intronic
1117110719 14:52451121-52451143 AAGGGTAAAAGGAGGGTGATGGG + Intronic
1119260767 14:73237100-73237122 ATGGGTAACAGCAGCGTGTGCGG + Intergenic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1121504704 14:94467993-94468015 ATGGGTAGATGAAGGGTGGAGGG + Intronic
1121792717 14:96711074-96711096 TTGGGTAACATGGGGGTGCAAGG + Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1124651879 15:31480076-31480098 AAGGGTAACTGGAGGTGGGAAGG - Exonic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1127546181 15:59996083-59996105 ATCGGTAAAAAGAGGATGGATGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129250449 15:74305956-74305978 AGGACTAACAGGAGAGTGGATGG + Intronic
1130560418 15:84953889-84953911 ATGGGCACCAGGAGGGATGAGGG + Intergenic
1131993146 15:98109719-98109741 TGGGGTAACAGGAGGATGAATGG - Intergenic
1132019091 15:98344924-98344946 ATGGGTGGGAGGTGGGTGGATGG + Intergenic
1132230405 15:100179215-100179237 ACGGGTAATAGGAGGCTGGCAGG - Intronic
1132507829 16:321155-321177 GTGGGTAGCAGGAGGCAGGAGGG - Intronic
1133825086 16:9271115-9271137 ATGTATAATAGGTGGGTGGATGG - Intergenic
1134224697 16:12381286-12381308 ATGGATAATGGGTGGGTGGATGG - Intronic
1134347975 16:13409216-13409238 ATGGGGAACTGGAAGGGGGATGG - Intergenic
1136598330 16:31266804-31266826 TTGGGGAACAGGGGTGTGGAAGG - Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1137396481 16:48119070-48119092 ATAGGAAGCAGGAGGGTGGGAGG - Intronic
1137579716 16:49626586-49626608 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579735 16:49626696-49626718 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579753 16:49626771-49626793 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579770 16:49626846-49626868 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579792 16:49626947-49626969 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579801 16:49626982-49627004 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579818 16:49627057-49627079 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579841 16:49627158-49627180 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579856 16:49627225-49627247 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579867 16:49627272-49627294 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579878 16:49627319-49627341 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579900 16:49627414-49627436 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579911 16:49627461-49627483 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579934 16:49627564-49627586 ATGGGTAGATGGAGGATGGATGG - Intronic
1137579999 16:49627862-49627884 ATGGGTAGATGGAGGATGGATGG - Intronic
1137580016 16:49627937-49627959 ATGGGTAGATGGAGGATGGATGG - Intronic
1137580049 16:49628087-49628109 ATGGGTAGATGGAGGGTGGATGG - Intronic
1137607986 16:49799569-49799591 ATGGGGAATAGGAGGGTGAGAGG - Intronic
1139787304 16:69404175-69404197 ATGGGTGGCAGGGGGGTAGAGGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1141031880 16:80596315-80596337 ATGGATAAAAGGATGATGGATGG + Intergenic
1141642010 16:85346913-85346935 ATGGTGAACAGGTGGGTGGATGG + Intergenic
1141642016 16:85346932-85346954 ATGGTGGACAGGTGGGTGGATGG + Intergenic
1142142705 16:88479699-88479721 CTGGGTAGCAGGTGGGTGGGGGG - Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143301453 17:5913649-5913671 ATGGATCACTGGAGGATGGATGG - Intronic
1144556353 17:16286108-16286130 ATGGGCCAGAGGTGGGTGGAGGG + Intronic
1144754745 17:17672347-17672369 CGGGGGATCAGGAGGGTGGAGGG + Intergenic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145272909 17:21414091-21414113 GTGGGTGTCAGGAGGGTGGTGGG + Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145311112 17:21701527-21701549 GTGGGTGTCAGGAGGGTGGTGGG + Intronic
1146076794 17:29738068-29738090 TGGGGTCACGGGAGGGTGGAGGG - Intronic
1148471366 17:47895874-47895896 CTGGGTTAGAGGTGGGTGGAAGG + Intergenic
1149305963 17:55346758-55346780 ATAGGTACCAGGTGGGTTGAGGG + Intergenic
1151440933 17:74128695-74128717 GTGGGACACAGGAGTGTGGATGG + Intergenic
1152034041 17:77861104-77861126 ATGGGTGAAAGGTGGATGGATGG + Intergenic
1152100809 17:78300883-78300905 TGGGGGAACAGGAAGGTGGAGGG - Intergenic
1152167947 17:78723194-78723216 GTGGGTAAGAGGCTGGTGGATGG - Intronic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152696538 17:81800504-81800526 AAGGGAAACAGGAGGGTGGTGGG - Intergenic
1152759868 17:82102161-82102183 ATGGGTCCCAGGAGGGGGCAGGG + Intronic
1152759881 17:82102197-82102219 ATGGGTCCCAGGAGGGGGCAGGG + Intronic
1152790040 17:82273810-82273832 CGGGGTAACAGGAGGGCAGAGGG - Intergenic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1157443197 18:47725720-47725742 ATGTGTATAAGGAGGCTGGAGGG - Intergenic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1159569692 18:70098784-70098806 TGGGGTAGGAGGAGGGTGGAGGG - Intronic
1160074937 18:75665624-75665646 ATGGTTTTCATGAGGGTGGAAGG - Intergenic
1161049770 19:2157040-2157062 ATGGATGACAGATGGGTGGATGG - Intronic
1161449077 19:4334594-4334616 ATGGGTAAATGGTAGGTGGATGG - Intronic
1162365350 19:10245379-10245401 AAGGGGAACAGGAGAATGGAAGG + Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162943508 19:14028422-14028444 AAGGGGAACAGGTGGCTGGATGG + Intronic
1163402760 19:17104191-17104213 AGGGGGACCAGCAGGGTGGAAGG + Intronic
1163764133 19:19153040-19153062 ATGGGTCCCTGGGGGGTGGACGG + Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1165243854 19:34486701-34486723 AGGGGTCCCAGGAGGGAGGAAGG - Intronic
1165699911 19:37929662-37929684 AAGGGTAGGAGGAGGGGGGAGGG - Intronic
1167095883 19:47374979-47375001 ATGGGTCACAGGCAGCTGGAGGG + Intronic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167577398 19:50324388-50324410 ACAGGGAACAGGAGGGTGGGGGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168523179 19:57068823-57068845 AGTGGTAAGAGGAGGCTGGAGGG + Intergenic
925511060 2:4625945-4625967 CTGGGAAACAGGAGGATGGCTGG + Intergenic
925836520 2:7951996-7952018 ATGGGCAACAGGAAGGAGGCTGG - Intergenic
925979308 2:9164230-9164252 AGGGGGAACAGGAGGGGGCATGG - Intergenic
926724091 2:15984046-15984068 TTGTGTAACAGGAGAGTGAAAGG - Intergenic
926846460 2:17146524-17146546 ATGGGGAGCAGGGGGGTGGGGGG + Intergenic
929697805 2:44134151-44134173 ATAGGTAATGGGAGGGTGAAAGG + Intergenic
930250967 2:49033685-49033707 ATAGGGAACAGGGGGGAGGAGGG - Intronic
931235936 2:60412749-60412771 ATGGGTTGCAGGAGGTTGGCGGG + Intergenic
931261835 2:60626777-60626799 ATGGGTAACAGGAGGCTGGGAGG - Intergenic
931482522 2:62656190-62656212 ATGGGGAACAGGAAGGTTGGTGG - Intergenic
931677920 2:64716684-64716706 ATGGGAAACAGGAGGGGAGGCGG - Intronic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931919924 2:67003937-67003959 ATGGGTAAGATGAGGGTAGCTGG + Intergenic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
933178920 2:79208063-79208085 ATGGGAATCAGGAGGGAGAAGGG - Intronic
933261996 2:80141384-80141406 AAGGTTCAAAGGAGGGTGGAAGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
936225835 2:110650187-110650209 ATGTGTAACAAGGGGGTGGGCGG + Intronic
936240962 2:110788460-110788482 AGAGGTAACAAGAGGTTGGAGGG + Intronic
937977054 2:127588741-127588763 ATGGGTAGTGGGTGGGTGGATGG + Intronic
938227337 2:129627251-129627273 ATAGGTCACAGGAGAGTGAAGGG + Intergenic
940356750 2:152752194-152752216 AATGGTAACAGAAGGGTAGAGGG - Intronic
940759795 2:157725259-157725281 AGGGGTAAGAGGAGGGGGAATGG + Intergenic
941336041 2:164245073-164245095 AAGGGAAACAGGAGGAAGGAAGG - Intergenic
942449733 2:176101287-176101309 AGGGCAGACAGGAGGGTGGAGGG - Intergenic
943297730 2:186159970-186159992 CATGGTAACAGGAGGGTGGGGGG - Intergenic
944285750 2:197948112-197948134 ATGAGAAACAGGATGGTAGATGG + Intronic
945851181 2:215009294-215009316 GAGGGGAACAGAAGGGTGGAGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
948725336 2:239930656-239930678 GTGGGAAACAGGGAGGTGGAAGG + Intronic
1169027758 20:2384801-2384823 TGGGGTAACAGGCAGGTGGAGGG + Intronic
1169357270 20:4917711-4917733 CTGGGCAACAGGAGGGTAGCAGG - Intronic
1171119470 20:22556293-22556315 ATGGGTAACAACAGGTTGGCAGG - Intergenic
1171214017 20:23339123-23339145 ATGGTAGAGAGGAGGGTGGAAGG - Intergenic
1171355974 20:24545612-24545634 ATGAGTAAGAGGAGGCTTGAGGG + Intronic
1172230773 20:33334154-33334176 ATGGGTAGATGGATGGTGGATGG + Intergenic
1172254848 20:33508572-33508594 ATGGGAAAGTGGAGGGTGGGAGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1173059518 20:39648121-39648143 ATGGGAAGCTGGAAGGTGGAGGG + Intergenic
1173999285 20:47362600-47362622 GTGAGCCACAGGAGGGTGGAGGG - Intergenic
1174404581 20:50294965-50294987 ATGGGGGGCAGGAGGGCGGAGGG + Intergenic
1174531814 20:51220315-51220337 CTGGTTAGCAGGAGGGTGCAAGG + Intergenic
1175486315 20:59349065-59349087 ATGAGGCACAGGAGAGTGGAGGG + Intergenic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176057881 20:63158378-63158400 ATGGGTGACTGGATGGTGAATGG + Intergenic
1176588232 21:8611118-8611140 TTGGGTCAGAGGAGGGGGGAGGG + Intergenic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1178213738 21:30569208-30569230 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1178394706 21:32232730-32232752 GTGGTTACCAGGAAGGTGGAAGG + Intergenic
1178536088 21:33411454-33411476 ATGGTGAACAGGCGTGTGGAGGG + Intronic
1178923887 21:36759457-36759479 ATGAGTAGCAGGAGTGTGGAAGG + Intronic
1179189115 21:39108293-39108315 ATGAGAAACAGGATGGAGGAGGG + Intergenic
1180271064 22:10588117-10588139 TTGGGTCAGAGGAGGGGGGAGGG + Intergenic
1181164155 22:20974500-20974522 GTGGGTGCCAGGAGGGTGGAGGG - Intronic
1181775950 22:25160378-25160400 AAGAGTAACAGGGAGGTGGAGGG - Intronic
1182051803 22:27317960-27317982 GTGGAAAGCAGGAGGGTGGAGGG - Intergenic
1182083515 22:27545505-27545527 ACGGGAGACAGGAGGTTGGAGGG - Intergenic
1182718011 22:32375638-32375660 GGGGGTATCAGGAGGGTTGATGG - Intronic
1183875767 22:40779589-40779611 ATGAGTGACAGGAGGGGGAAAGG + Intronic
1184444510 22:44539521-44539543 ATGGGTAGGTGGATGGTGGATGG + Intergenic
1184444604 22:44539903-44539925 ATGGGTAGGTGGACGGTGGATGG + Intergenic
1184780771 22:46648271-46648293 ATGGGTAAATGTTGGGTGGATGG + Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184878149 22:47288492-47288514 ATGGATGACAGGTGGGTAGATGG - Intergenic
1184889227 22:47369282-47369304 ATGGGGGACAGGAGGGTTGACGG + Intergenic
950025794 3:9819163-9819185 ATGGGTGACAGGTGGGAGGATGG - Intronic
950307037 3:11923959-11923981 AAGGCAATCAGGAGGGTGGAGGG - Intergenic
950667216 3:14504976-14504998 GTGGGTACCAGGAGGGAGGGAGG + Intronic
950930412 3:16783564-16783586 ATGGGTAGCTGGAGAGGGGATGG - Intergenic
951272235 3:20640251-20640273 ATGGCTCACAGGAGGGAGGAAGG + Intergenic
951723171 3:25723907-25723929 ATGGGTCACTGGTGGGAGGAGGG - Intronic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953564147 3:44016666-44016688 AGGGGTGACAGGTGGGGGGAGGG + Intergenic
953926727 3:46986330-46986352 ATGGCCACCAGGAGGGTGGGAGG + Intronic
955952568 3:64257293-64257315 GTTGGGAACAGAAGGGTGGAGGG - Intronic
956541436 3:70344417-70344439 ATGGGGAACTGGAAGGGGGATGG - Intergenic
960231131 3:115228933-115228955 AGGTGTCACAGGAGAGTGGAAGG + Intergenic
960715349 3:120569521-120569543 ATGAGGAACAGGAGAGTTGATGG + Intergenic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
964045878 3:152325977-152325999 AGGGGTAAAAGGAGTGTGAAAGG - Intronic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
967043180 3:185712887-185712909 ATGGGTAAATGGAGGCTGTAGGG - Intronic
971374375 4:26044972-26044994 ATGGGAAAGAGGGGAGTGGATGG - Intergenic
973575960 4:52289595-52289617 ATGGGTGCAAGCAGGGTGGAAGG - Intergenic
974439444 4:61898077-61898099 ACAGGTAAATGGAGGGTGGAGGG - Intronic
975362102 4:73482759-73482781 ATGGGCAAAAGAAGGGTGGATGG - Intronic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
976618302 4:87100554-87100576 ATGGGTAACAAGCTTGTGGAGGG - Intronic
977252060 4:94700572-94700594 ATGGGTCCCTGGAGGATGGAGGG - Intergenic
978112201 4:104976865-104976887 GTGAGTATCAGGAGGGTTGAGGG - Intergenic
978197867 4:105991541-105991563 AATGCTAACAGGAGGTTGGAGGG - Intronic
978207581 4:106096674-106096696 ATGACTGACAGGATGGTGGAGGG + Intronic
982062211 4:151615937-151615959 ATGGGTGACAGGAGGGTGGTAGG + Intronic
983991680 4:174127655-174127677 GTGGGTTACAGGAAAGTGGAAGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
985293181 4:188407019-188407041 ATGGGGAGCTGGAAGGTGGATGG - Intergenic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985709200 5:1418832-1418854 ATGGATGACGGGTGGGTGGATGG - Intronic
986230964 5:5864561-5864583 ATGGGGAGCTGGAAGGTGGAGGG + Intergenic
987134056 5:14884676-14884698 ATGGGAAAGAGGGGGTTGGAGGG + Intergenic
987151186 5:15041822-15041844 ATGGTTATCAGGGTGGTGGAGGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988871073 5:35390572-35390594 ATGGGAAAGTGGAGGGTGGGAGG + Intergenic
989134971 5:38144679-38144701 AAGGGTAGCTGGAGGCTGGATGG + Intergenic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
992377557 5:76203327-76203349 ATGGGTAAATGAAGGGTGGGTGG + Intronic
992818856 5:80473362-80473384 ATGGGTAACTGAAGAGAGGAAGG - Intronic
993068282 5:83128114-83128136 TGGGGTGGCAGGAGGGTGGACGG - Intronic
994301426 5:98152726-98152748 GTGGGAAACTGGAAGGTGGAAGG - Intergenic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
996509227 5:124300326-124300348 ATCGGAAACAGGGAGGTGGAAGG - Intergenic
996893604 5:128453913-128453935 GTGAGGTACAGGAGGGTGGAAGG - Intronic
997665570 5:135627250-135627272 ATGGGAGACTGGAGGGTGGGAGG + Intergenic
998868521 5:146529853-146529875 ATGGGGAACTGGAAGGGGGATGG - Intergenic
999073588 5:148773670-148773692 GTGGATAAGAGAAGGGTGGAGGG + Intergenic
1001108496 5:168875791-168875813 AAGGGAAAGAGAAGGGTGGAGGG + Intronic
1001147565 5:169198088-169198110 ATGGGTAAATGGTGGTTGGACGG - Intronic
1001230083 5:169979147-169979169 ATGGGGAACAGAGGGGTGGAGGG - Intronic
1002275416 5:178101380-178101402 AAGGGTAAAAGTAGGCTGGAGGG - Intergenic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1004167564 6:13270389-13270411 CTGGGAAGCAGGAGGGTGGGGGG - Intronic
1004955791 6:20726295-20726317 ATGGAGAACAGGTGGGGGGAGGG - Intronic
1005361408 6:25034871-25034893 ATGGGAAACTGGAGAATGGAAGG - Intronic
1005574900 6:27181631-27181653 ATTGGGAACAACAGGGTGGATGG - Intergenic
1005598770 6:27405720-27405742 ATGGGTTACAGTCGTGTGGATGG - Intergenic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1005804566 6:29462244-29462266 AAGGGCAAGTGGAGGGTGGATGG - Exonic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1006771924 6:36560928-36560950 AGGGGCATCAGGAGTGTGGATGG - Intergenic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1007078963 6:39085355-39085377 ACGGGAAACAGCAGGGAGGAAGG - Intronic
1007789177 6:44299191-44299213 ATGGGGATCAGGAGTGTGGATGG - Intronic
1008219075 6:48833887-48833909 ATGGGGTGTAGGAGGGTGGAGGG + Intergenic
1008370372 6:50724118-50724140 AGGGGTAACATGGGGGAGGAGGG + Intronic
1009510939 6:64548885-64548907 ATGGGCAACAGTTGGGAGGAAGG - Intronic
1011247442 6:85334507-85334529 ATGGTTACCAGAAGGTTGGAAGG + Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1014015883 6:116529441-116529463 GTGGGAAGCAGGAGGGTGCATGG - Intronic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1016117380 6:140303690-140303712 ATGGGTAGCTGGAGAGGGGATGG + Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018326707 6:162677980-162678002 ATGGGTGAGTGGAGGGTGGGAGG - Intronic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019914665 7:4125054-4125076 ATGGGTAATGGGTGGATGGATGG + Intronic
1019914730 7:4125373-4125395 ATGGGTGATGGGTGGGTGGATGG + Intronic
1021491807 7:21227162-21227184 ATAGGTGACAGGTGGGTGGGTGG - Intergenic
1022901072 7:34811256-34811278 ATGGGGAACTGGAAGGGGGATGG + Intronic
1023093077 7:36634042-36634064 ATGGGAAACAGGGCGGAGGAGGG + Intronic
1023654474 7:42406049-42406071 ATGGGGAGCTGGAGGATGGATGG + Intergenic
1024171330 7:46791039-46791061 ATGAGTACAAGGAGGGTGAAGGG + Intergenic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026762023 7:73134000-73134022 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1026882976 7:73919377-73919399 ATTGGTTTCAGGAGGCTGGAGGG - Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027038364 7:74942824-74942846 ATGAGTAGCAGGGGTGTGGAGGG + Intergenic
1027085199 7:75258658-75258680 ATGAGTAGCAGGGGTGTGGAGGG - Intergenic
1028206527 7:88023828-88023850 AGGGGTAACAGGAGGGTAGGGGG - Intronic
1028984237 7:96997381-96997403 ATGGGGAGCAGGAGGGAGGGGGG + Intergenic
1029548693 7:101224783-101224805 ATGGGTGACAGGGAGGTGGCGGG + Intergenic
1031056095 7:116994159-116994181 AGGGTTAGCAGGAAGGTGGAAGG - Intronic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031995268 7:128226487-128226509 ATGGACAATAGGAGGATGGAAGG - Intergenic
1031995273 7:128226510-128226532 ATGGACAATAGGAGGATGGAAGG - Intergenic
1032416934 7:131743032-131743054 GTGGGTGACAGGTGGGTGGGAGG - Intergenic
1032464889 7:132137907-132137929 ATGAGTATGAGGATGGTGGAAGG + Intronic
1033885600 7:145941170-145941192 GAGGGGAACAGCAGGGTGGAGGG - Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035214872 7:157358048-157358070 GTGGGTGACAGAATGGTGGAAGG + Intronic
1035278887 7:157765150-157765172 ATGGATAAAAGAAGGATGGATGG - Intronic
1035278928 7:157765341-157765363 ATGGGTGAAAGGATGATGGATGG - Intronic
1035288564 7:157822291-157822313 ATGGATAGCAGATGGGTGGATGG - Intronic
1035651537 8:1269420-1269442 AAGTGTTACAGGAAGGTGGATGG - Intergenic
1037199541 8:16235267-16235289 ATGGGGCACAGGAGGGTGTTTGG + Intronic
1039456822 8:37712701-37712723 TTTGGGAACAGGTGGGTGGAGGG + Intergenic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040343231 8:46456086-46456108 ATGGGTATCAGGCTGGGGGATGG + Intergenic
1040353830 8:46596008-46596030 ATGGGGAATAGGTGGGTGGGTGG + Intergenic
1041012753 8:53559990-53560012 TTGGGGAGCAGGAGGGTTGAGGG - Intergenic
1042405165 8:68396553-68396575 AATCGTAACAGGAGGTTGGAAGG - Intronic
1042576041 8:70219671-70219693 AAGGGCAGGAGGAGGGTGGAGGG + Intronic
1042751698 8:72164337-72164359 ATGGCCAGCAGGAGGGTGGGGGG - Intergenic
1044462240 8:92458827-92458849 GAGGGTAAAAGGTGGGTGGATGG + Intergenic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045251524 8:100487045-100487067 AAGGGGAACAGGAGTGTGGAAGG - Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047778392 8:128092170-128092192 ATGGGAAACAGCAGGGGGGCTGG - Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1049361142 8:142213055-142213077 AGGGGAGACAGGAAGGTGGAGGG - Intronic
1049364269 8:142229156-142229178 ATGGATGAATGGAGGGTGGATGG + Intronic
1050920906 9:11199517-11199539 ATGAGCAACAGCAGGGGGGAAGG - Intergenic
1051111580 9:13644041-13644063 AGGGGTAAGAGCAGGATGGAAGG + Intergenic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1052280149 9:26723692-26723714 AAGGGAAGCCGGAGGGTGGAAGG + Intergenic
1053392830 9:37748059-37748081 ATCGGTAACAGGAGATGGGAAGG - Intronic
1057072914 9:92115503-92115525 CTGGTTGACAGGAGGCTGGACGG + Intergenic
1057132873 9:92666839-92666861 GTGGGCTACAGGAGGGTGGGAGG - Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1059051612 9:110932814-110932836 ATGGGTTGGAGGAGGGGGGATGG - Intronic
1059252207 9:112895734-112895756 ATGGATAATGGGTGGGTGGATGG - Intergenic
1059252254 9:112895908-112895930 ATGGGTGATAGGTGGGTAGATGG - Intergenic
1059393715 9:114017423-114017445 ACGGGCACCAGGAGGATGGAAGG - Intronic
1059769014 9:117410390-117410412 ACTGGTAACATGAGGGTGGTGGG - Intronic
1060423599 9:123486785-123486807 GTGGTCAATAGGAGGGTGGAGGG - Intronic
1060769519 9:126321779-126321801 ATGGCTGAGAGGAGGATGGAGGG + Intergenic
1061217946 9:129232577-129232599 ATGGATGACAGATGGGTGGATGG - Intergenic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062201236 9:135303911-135303933 ATGGATAAATGGAGGGTGGATGG + Intergenic
1185581097 X:1211984-1212006 ATAGATAACAGCTGGGTGGATGG + Intronic
1185587718 X:1252943-1252965 ATGGGTACCAGGAGGGGGGGTGG - Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185762627 X:2700393-2700415 ATGGATAAAAGGAGGATGCATGG - Intronic
1187563731 X:20427685-20427707 AGGGGAGACAGGAAGGTGGAAGG - Intergenic
1187833952 X:23411869-23411891 ATGGGTAGTGGGAGGGTGGCGGG + Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1191736003 X:64388407-64388429 ATATGTAACAGGAGGAAGGAAGG + Intronic
1192479570 X:71473310-71473332 ATGGATAACAGGGGGTTGGCAGG + Intronic
1194119463 X:89942998-89943020 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic
1194202395 X:90969598-90969620 AAGGGTAGTGGGAGGGTGGAGGG + Intergenic
1194994274 X:100575656-100575678 ATGGGCAGCAGGAGGGTTAAAGG - Intergenic
1195612195 X:106880514-106880536 ATGGTTACCAGAAGGTTGGAAGG + Intronic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic
1196119078 X:112029129-112029151 AAGGGTAACGGGGGGTTGGAGGG - Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1197698987 X:129582799-129582821 ATGGATAACAGTAGTGTGGGAGG + Intronic
1198395188 X:136212766-136212788 AGGGATAACAGGAGTGAGGAGGG - Intergenic
1199827258 X:151512804-151512826 ATGGGGAAAAGCAGGCTGGAGGG + Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200259616 X:154606107-154606129 AGGGGTATAAGGAGGGTTGAGGG - Intergenic
1200472336 Y:3600555-3600577 ATGGGGAGCTGGAAGGTGGAGGG - Intergenic