ID: 995512391

View in Genome Browser
Species Human (GRCh38)
Location 5:112922045-112922067
Sequence TGGCCGGGGGTCGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995512391_995512401 18 Left 995512391 5:112922045-112922067 CCAGCGGCGGCGACCCCCGGCCA 0: 1
1: 1
2: 1
3: 10
4: 125
Right 995512401 5:112922086-112922108 GCTCCTGTTCACGCCGGTTTTGG 0: 1
1: 0
2: 0
3: 1
4: 37
995512391_995512400 12 Left 995512391 5:112922045-112922067 CCAGCGGCGGCGACCCCCGGCCA 0: 1
1: 1
2: 1
3: 10
4: 125
Right 995512400 5:112922080-112922102 GATGAAGCTCCTGTTCACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 62
995512391_995512403 30 Left 995512391 5:112922045-112922067 CCAGCGGCGGCGACCCCCGGCCA 0: 1
1: 1
2: 1
3: 10
4: 125
Right 995512403 5:112922098-112922120 GCCGGTTTTGGCCTCGAGCTTGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995512391 Original CRISPR TGGCCGGGGGTCGCCGCCGC TGG (reversed) Intronic
901540011 1:9909859-9909881 CGCCCGGGGGTCGCCTCCACAGG - Intronic
903830197 1:26169979-26170001 TGGCCATGGGTCGCTCCCGCCGG + Exonic
906314158 1:44775684-44775706 TGGCCGGGGGTCGGGGCGTCTGG - Intronic
910788000 1:91021665-91021687 TGAGCGGCGGCCGCCGCCGCGGG - Intronic
913661538 1:121009888-121009910 TGGTCGCGGGTCGCCGCGTCCGG + Intergenic
914677871 1:149917774-149917796 AGGACGGGGGTCCCGGCCGCGGG + Exonic
915616910 1:157046000-157046022 TCGGCGGGAGTCGCGGCCGCGGG - Intergenic
920033099 1:203048985-203049007 TGGGCGGGGCTGGCCGCAGCCGG - Intronic
921355501 1:214281230-214281252 TGGCGGCGGGGCGCGGCCGCCGG - Exonic
1063593327 10:7411829-7411851 TGCCCGGGGCTCACGGCCGCCGG - Intergenic
1064354391 10:14604290-14604312 GGGCCGCTGGGCGCCGCCGCGGG - Intronic
1065022325 10:21510383-21510405 TGGCCGGGGGCTGCTGGCGCGGG - Intergenic
1075698030 10:124449957-124449979 GGGCCGGCGGTCGGCGGCGCGGG + Exonic
1077186628 11:1238389-1238411 TGGCCGGGGGTTGGTTCCGCTGG + Intronic
1077214896 11:1391105-1391127 TGGCCTGGGTTCGGCCCCGCAGG - Intronic
1078524225 11:12088386-12088408 TGGCCTGGGGTGGCCTCTGCTGG - Intergenic
1078987060 11:16607066-16607088 TGGCCGGGAGCCGCGGCTGCCGG - Intronic
1079353532 11:19712936-19712958 TGGCCGTGGGGCGCGGGCGCCGG - Intronic
1088481101 11:110296783-110296805 TGGCCGGGGGTCGCGGTCTGGGG + Intergenic
1090258620 11:125303151-125303173 TGGCCTGGGGTCCCAGCTGCAGG - Intronic
1091383408 12:77485-77507 TGTCTGGGGGTCACCGCAGCAGG + Intronic
1096157080 12:49346727-49346749 TGGGCGGCGGCGGCCGCCGCTGG - Intergenic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1097227668 12:57488127-57488149 TTGCCGGTGCTGGCCGCCGCCGG + Exonic
1102518081 12:113463429-113463451 TGGCCCCGGCTCGACGCCGCTGG - Exonic
1113784369 13:112994729-112994751 CTGCCTGGGGTCGCCGCTGCGGG + Intronic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1122183419 14:99971751-99971773 TGCCTGGGGGCCGCCGCCGGGGG - Intronic
1124014334 15:25863096-25863118 TGGCCGCGTGTCGCCGCGCCCGG + Exonic
1127880866 15:63157557-63157579 TGGTAGGGGGACGCCGCAGCAGG + Exonic
1128635400 15:69299224-69299246 TGGCCGAGCCGCGCCGCCGCCGG - Intronic
1129348103 15:74937566-74937588 TGACCGAGAGTGGCCGCCGCCGG - Intronic
1132519692 16:381572-381594 GGGTTGGGGGTCCCCGCCGCGGG - Intronic
1132828864 16:1918060-1918082 TGGCCAGCGGTCCCGGCCGCCGG - Exonic
1136641581 16:31569557-31569579 CGGCTGGTGGTCGCCGCGGCCGG + Intergenic
1137454790 16:48610006-48610028 TGAGGGGGCGTCGCCGCCGCCGG - Exonic
1139410008 16:66751521-66751543 TCGCCGGCGGCCGCCACCGCGGG + Exonic
1139534293 16:67562232-67562254 TGGGCGGAGGCCGCCGCCCCTGG - Intergenic
1139534611 16:67563347-67563369 AGTCCGCGCGTCGCCGCCGCTGG + Intronic
1142283040 16:89159472-89159494 TGGGCGGAGGGCGCTGCCGCAGG + Intergenic
1142300878 16:89257232-89257254 TGGTGGGGGGTGGCCGCCTCCGG + Intergenic
1142849505 17:2697567-2697589 GCACCGGGGGTCCCCGCCGCTGG - Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146723907 17:35142218-35142240 GGGGCGGGGGGCGTCGCCGCGGG - Intronic
1147393345 17:40122862-40122884 TGCCCGGGGGCCGCCCCGGCCGG - Intronic
1149610581 17:57955497-57955519 GGGCCCGGGGGCGCCGCAGCCGG - Intergenic
1149996719 17:61409640-61409662 AGGCCGGGCGGCGCCGGCGCGGG + Intergenic
1150549067 17:66192201-66192223 GCGCCGGTGGTCGCCGCCGCCGG - Intergenic
1150791939 17:68205907-68205929 TAGCCGGAGGAAGCCGCCGCTGG + Intergenic
1152426346 17:80220564-80220586 TCGCCGGGGGCAGCCGACGCGGG + Intronic
1152713636 17:81887662-81887684 TGGCGGGGGGTCCCCGCTCCTGG - Intergenic
1152843560 17:82585941-82585963 TGGCCTGTGGTAGCTGCCGCTGG - Exonic
1160456536 18:79006131-79006153 TGGCCGGTGCTCGACGCCTCCGG - Intergenic
1160631203 18:80247409-80247431 GGGCCTGGGGGCGCCGCCCCCGG - Exonic
1160668468 19:344586-344608 CGGCCGGGGGCGGCCGCCGATGG + Intronic
1161077110 19:2291149-2291171 TGGCCAGGTGGCGCAGCCGCAGG + Exonic
1161389959 19:4015703-4015725 TGCCCGGGGGCCGCCTCCGGAGG + Intronic
1161460167 19:4391853-4391875 TGGCCCAGGGTCCACGCCGCCGG + Intronic
1162021225 19:7869445-7869467 GGGGCGGGGGTCGCCGACTCGGG + Exonic
1168297348 19:55383871-55383893 TGGTCGGCGCCCGCCGCCGCGGG - Exonic
926095896 2:10080375-10080397 CGGGCGGGGGTCGCGGCCGGAGG + Exonic
927714155 2:25341740-25341762 CGGGCGGGGGGCGCCGCGGCTGG - Intronic
931348843 2:61470863-61470885 GGGCCGGCGGTCCCCGCAGCGGG + Intergenic
935292569 2:101622541-101622563 GGGCAGGGGGTCGCCGGCGGGGG - Intergenic
935652971 2:105398509-105398531 TGGCCGCGGGTCCCAGCCGGCGG - Intronic
938071248 2:128309535-128309557 TGGCCGTGGGTGACCGCCCCCGG - Intronic
938303015 2:130229380-130229402 TGGCAGGTGGGCGGCGCCGCAGG + Intergenic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
942116819 2:172736054-172736076 TCGCCGGGGGCCGCAGCCGGGGG + Intronic
942890553 2:180981213-180981235 CGGCCGTGGCTCGCCTCCGCGGG + Intronic
945270234 2:207930925-207930947 TGGCAGAGGATCTCCGCCGCAGG - Exonic
1169914354 20:10672122-10672144 GGGCCGGGGGCGGCCGCCGCAGG - Intronic
1170890044 20:20368728-20368750 GAGCAGCGGGTCGCCGCCGCAGG - Exonic
1172389843 20:34559125-34559147 TGGCCGGGGGCCGCCCCTCCGGG + Intronic
1173594016 20:44247434-44247456 TGGGCGGGGCTGGCCGCCTCGGG - Exonic
1173939137 20:46894998-46895020 CGGCCTGGGGTGGGCGCCGCTGG - Intronic
1176111636 20:63413610-63413632 TGGCCGGGGGTCTCTGGCCCAGG - Intronic
1176281770 20:64317302-64317324 TGTCTGGGGGTCACCGCAGCAGG - Intergenic
1176550021 21:8217023-8217045 GGGCCGGCGGCGGCCGCCGCGGG + Intergenic
1178103951 21:29298686-29298708 GGGGCAGGGGTCGCCGCGGCCGG - Intronic
1178707640 21:34888812-34888834 AGGGCGCGGCTCGCCGCCGCCGG + Intronic
1179605617 21:42513742-42513764 GAGCCGGGGGTCGCGGCGGCCGG + Intronic
1180095719 21:45554519-45554541 TGGCCGGGTCTGGCCACCGCGGG + Intergenic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1184691533 22:46119499-46119521 TGGCCTGGGGTCACCTCCGGGGG + Intergenic
1184767113 22:46577603-46577625 GGACCGGGGGTCACCGACGCTGG + Intronic
1185409587 22:50674781-50674803 GGGCCGGGGGTCCCGGGCGCCGG - Intergenic
1203254911 22_KI270733v1_random:133349-133371 GGGCCGGCGGCGGCCGCCGCGGG + Intergenic
1203262967 22_KI270733v1_random:178428-178450 GGGCCGGCGGCGGCCGCCGCGGG + Intergenic
950641674 3:14352394-14352416 TGGCCTGGGGTAGCTGCCGTTGG - Intergenic
968450540 4:674120-674142 GGGCCGGGGGTCGCAGCCCGCGG + Intronic
968517187 4:1020369-1020391 TGGGCTGTGGTCGCCGCTGCAGG + Intronic
968835924 4:2964049-2964071 TGTCCTGGCGCCGCCGCCGCCGG - Exonic
975666939 4:76741694-76741716 TCGCCGGTGGCCGCCGCCTCGGG + Exonic
985661954 5:1161833-1161855 TTGCTGGGGGCGGCCGCCGCAGG + Intergenic
988547652 5:32173770-32173792 TGGGCGGGGGGCGGCGGCGCGGG - Intronic
988547772 5:32174212-32174234 TGGCCGGGCGTCGGCGGGGCAGG + Exonic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
995764597 5:115602058-115602080 AGGGCGGGGGCCGCCGCCGGGGG - Intronic
999300042 5:150485650-150485672 TTCCCGGGGGTCACCGCCTCGGG + Intergenic
1002093490 5:176817840-176817862 AGGCCGGGGGTGGGTGCCGCGGG + Intronic
1004044617 6:12012216-12012238 CGGGCGGGGGCCGCAGCCGCCGG - Intronic
1007704291 6:43781479-43781501 TGGCCTGGGGACACCGCCTCCGG + Intronic
1019120785 6:169801977-169801999 AGGCAGGGGGTCGCAGCCGCAGG - Intergenic
1019530651 7:1501632-1501654 TGGCCCGGGCTCTCGGCCGCCGG - Intronic
1019536075 7:1530612-1530634 TGGCCGGGGGGCGTGGCCGCGGG + Intergenic
1019726695 7:2606743-2606765 TGGCTGGGGCTCGCCGCCCAGGG - Intronic
1022363375 7:29685054-29685076 GGGCCGGAGGCCGCCGCCGCGGG - Intergenic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1024226142 7:47328104-47328126 TGGGTGGGGGACGCCACCGCTGG - Intronic
1024965309 7:55018880-55018902 TGGCCTTGGGTCCCCGCTGCTGG + Intergenic
1025976864 7:66377047-66377069 TGGCCTGGGGAGGCCGCGGCCGG + Intronic
1025988270 7:66474622-66474644 GGGCCGGGGATGGCCGCGGCAGG - Intergenic
1027211262 7:76150522-76150544 GGGCCGGGGATGGCCGCGGCAGG - Intergenic
1029207668 7:98878995-98879017 TGGCCGGGGGGCGCCTCCGGAGG - Intronic
1029207703 7:98879106-98879128 TGGCCCGGCGGCGCCGCCTCAGG + Intronic
1032097723 7:128947757-128947779 GGGCCCGGGGTGGCCGCCCCCGG - Exonic
1032344437 7:131106169-131106191 GGGCCGGCGTTCCCCGCCGCGGG - Intergenic
1033299947 7:140176701-140176723 TGGCCGGCGGTGGCGGCTGCGGG + Intronic
1034418982 7:150979188-150979210 TGGGCCGTGGCCGCCGCCGCAGG - Intergenic
1035169967 7:157011600-157011622 TGGCCGGGGGTCGCAGCGGCAGG - Intergenic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1037879533 8:22566078-22566100 AGGACCGGGGTCGCGGCCGCCGG + Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1041384045 8:57279984-57280006 TGGCCAGGGGTCCGCGCTGCTGG - Intergenic
1049585410 8:143430512-143430534 GGGCGGGGGGGCGCCGGCGCGGG + Intergenic
1049802151 8:144522850-144522872 GGGCCGGGGCTCGCTGCCGGCGG + Exonic
1052494965 9:29213647-29213669 TGGCCGGGGGCCGCGGGCGCAGG - Intergenic
1053409139 9:37904260-37904282 TGGCCGCAGGCCGCCGCGGCGGG + Intronic
1053919441 9:42973289-42973311 GGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1054380778 9:64487069-64487091 TGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1054514969 9:66029242-66029264 TGGCTGGAGGGCGCCGCCGCGGG - Intergenic
1059354423 9:113687877-113687899 GGGCCTGGCGTCGCCGTCGCGGG + Intergenic
1062364723 9:136203209-136203231 CGGCCGGGGGGCGGGGCCGCGGG + Intronic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1189915562 X:45851787-45851809 TAGCCGCGGGCGGCCGCCGCGGG - Intergenic
1192847868 X:74924807-74924829 TGGCTCGGGGTGGCGGCCGCAGG - Intronic
1197745975 X:129932411-129932433 GGGCCGCGGGGCGCGGCCGCGGG - Intergenic