ID: 995513523

View in Genome Browser
Species Human (GRCh38)
Location 5:112931314-112931336
Sequence CAGCATATTTTGTTGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995513521_995513523 14 Left 995513521 5:112931277-112931299 CCTATTTTGTGTTAGACAATTTG No data
Right 995513523 5:112931314-112931336 CAGCATATTTTGTTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995513523 Original CRISPR CAGCATATTTTGTTGGAGTC AGG Intergenic
No off target data available for this crispr