ID: 995516601

View in Genome Browser
Species Human (GRCh38)
Location 5:112960433-112960455
Sequence GCCCCTGCACAGATGGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995516601_995516609 20 Left 995516601 5:112960433-112960455 CCTAGATCCATCTGTGCAGGGGC No data
Right 995516609 5:112960476-112960498 CTCCTTAGGCCTCTGGTGCTAGG No data
995516601_995516606 13 Left 995516601 5:112960433-112960455 CCTAGATCCATCTGTGCAGGGGC No data
Right 995516606 5:112960469-112960491 TGTCACCCTCCTTAGGCCTCTGG No data
995516601_995516604 6 Left 995516601 5:112960433-112960455 CCTAGATCCATCTGTGCAGGGGC No data
Right 995516604 5:112960462-112960484 TTCCAGCTGTCACCCTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995516601 Original CRISPR GCCCCTGCACAGATGGATCT AGG (reversed) Intergenic
No off target data available for this crispr