ID: 995520975

View in Genome Browser
Species Human (GRCh38)
Location 5:113005008-113005030
Sequence CGGGCTCTATCTAGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995520975_995520981 3 Left 995520975 5:113005008-113005030 CCAGCTACTCTAGATAGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 995520981 5:113005034-113005056 CAGGAGAATTGCTTGAACTCGGG 0: 2028
1: 37293
2: 109292
3: 210933
4: 194091
995520975_995520982 12 Left 995520975 5:113005008-113005030 CCAGCTACTCTAGATAGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 995520982 5:113005043-113005065 TGCTTGAACTCGGGAAGCAGAGG 0: 29
1: 875
2: 10608
3: 47110
4: 99247
995520975_995520980 2 Left 995520975 5:113005008-113005030 CCAGCTACTCTAGATAGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 995520980 5:113005033-113005055 GCAGGAGAATTGCTTGAACTCGG 0: 2253
1: 36965
2: 88210
3: 154472
4: 99545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995520975 Original CRISPR CGGGCTCTATCTAGAGTAGC TGG (reversed) Intronic