ID: 995520980

View in Genome Browser
Species Human (GRCh38)
Location 5:113005033-113005055
Sequence GCAGGAGAATTGCTTGAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381445
Summary {0: 2253, 1: 36965, 2: 88210, 3: 154472, 4: 99545}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995520974_995520980 3 Left 995520974 5:113005007-113005029 CCCAGCTACTCTAGATAGAGCCC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 995520980 5:113005033-113005055 GCAGGAGAATTGCTTGAACTCGG 0: 2253
1: 36965
2: 88210
3: 154472
4: 99545
995520973_995520980 11 Left 995520973 5:113004999-113005021 CCTGTAATCCCAGCTACTCTAGA 0: 161
1: 10531
2: 123266
3: 259767
4: 225093
Right 995520980 5:113005033-113005055 GCAGGAGAATTGCTTGAACTCGG 0: 2253
1: 36965
2: 88210
3: 154472
4: 99545
995520975_995520980 2 Left 995520975 5:113005008-113005030 CCAGCTACTCTAGATAGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 995520980 5:113005033-113005055 GCAGGAGAATTGCTTGAACTCGG 0: 2253
1: 36965
2: 88210
3: 154472
4: 99545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995520980 Original CRISPR GCAGGAGAATTGCTTGAACT CGG Intronic