ID: 995520981

View in Genome Browser
Species Human (GRCh38)
Location 5:113005034-113005056
Sequence CAGGAGAATTGCTTGAACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553637
Summary {0: 2028, 1: 37293, 2: 109292, 3: 210933, 4: 194091}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995520974_995520981 4 Left 995520974 5:113005007-113005029 CCCAGCTACTCTAGATAGAGCCC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 995520981 5:113005034-113005056 CAGGAGAATTGCTTGAACTCGGG 0: 2028
1: 37293
2: 109292
3: 210933
4: 194091
995520975_995520981 3 Left 995520975 5:113005008-113005030 CCAGCTACTCTAGATAGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 995520981 5:113005034-113005056 CAGGAGAATTGCTTGAACTCGGG 0: 2028
1: 37293
2: 109292
3: 210933
4: 194091
995520973_995520981 12 Left 995520973 5:113004999-113005021 CCTGTAATCCCAGCTACTCTAGA 0: 161
1: 10531
2: 123266
3: 259767
4: 225093
Right 995520981 5:113005034-113005056 CAGGAGAATTGCTTGAACTCGGG 0: 2028
1: 37293
2: 109292
3: 210933
4: 194091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995520981 Original CRISPR CAGGAGAATTGCTTGAACTC GGG Intronic