ID: 995520982

View in Genome Browser
Species Human (GRCh38)
Location 5:113005043-113005065
Sequence TGCTTGAACTCGGGAAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157869
Summary {0: 29, 1: 875, 2: 10608, 3: 47110, 4: 99247}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995520974_995520982 13 Left 995520974 5:113005007-113005029 CCCAGCTACTCTAGATAGAGCCC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 995520982 5:113005043-113005065 TGCTTGAACTCGGGAAGCAGAGG 0: 29
1: 875
2: 10608
3: 47110
4: 99247
995520973_995520982 21 Left 995520973 5:113004999-113005021 CCTGTAATCCCAGCTACTCTAGA 0: 161
1: 10531
2: 123266
3: 259767
4: 225093
Right 995520982 5:113005043-113005065 TGCTTGAACTCGGGAAGCAGAGG 0: 29
1: 875
2: 10608
3: 47110
4: 99247
995520979_995520982 -8 Left 995520979 5:113005028-113005050 CCGAGGCAGGAGAATTGCTTGAA 0: 1233
1: 3603
2: 8547
3: 14082
4: 26338
Right 995520982 5:113005043-113005065 TGCTTGAACTCGGGAAGCAGAGG 0: 29
1: 875
2: 10608
3: 47110
4: 99247
995520975_995520982 12 Left 995520975 5:113005008-113005030 CCAGCTACTCTAGATAGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 995520982 5:113005043-113005065 TGCTTGAACTCGGGAAGCAGAGG 0: 29
1: 875
2: 10608
3: 47110
4: 99247
995520978_995520982 -7 Left 995520978 5:113005027-113005049 CCCGAGGCAGGAGAATTGCTTGA 0: 578
1: 1511
2: 2638
3: 2413
4: 2613
Right 995520982 5:113005043-113005065 TGCTTGAACTCGGGAAGCAGAGG 0: 29
1: 875
2: 10608
3: 47110
4: 99247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995520982 Original CRISPR TGCTTGAACTCGGGAAGCAG AGG Intronic