ID: 995523864

View in Genome Browser
Species Human (GRCh38)
Location 5:113035312-113035334
Sequence CTGCCATTGTCACCACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995523861_995523864 22 Left 995523861 5:113035267-113035289 CCTTGACATCTGTTCAACAGCAA 0: 1
1: 0
2: 1
3: 9
4: 166
Right 995523864 5:113035312-113035334 CTGCCATTGTCACCACACCCAGG 0: 1
1: 0
2: 1
3: 14
4: 187
995523858_995523864 30 Left 995523858 5:113035259-113035281 CCCCTCATCCTTGACATCTGTTC 0: 1
1: 0
2: 3
3: 38
4: 262
Right 995523864 5:113035312-113035334 CTGCCATTGTCACCACACCCAGG 0: 1
1: 0
2: 1
3: 14
4: 187
995523859_995523864 29 Left 995523859 5:113035260-113035282 CCCTCATCCTTGACATCTGTTCA 0: 1
1: 0
2: 3
3: 42
4: 468
Right 995523864 5:113035312-113035334 CTGCCATTGTCACCACACCCAGG 0: 1
1: 0
2: 1
3: 14
4: 187
995523860_995523864 28 Left 995523860 5:113035261-113035283 CCTCATCCTTGACATCTGTTCAA 0: 1
1: 0
2: 4
3: 36
4: 288
Right 995523864 5:113035312-113035334 CTGCCATTGTCACCACACCCAGG 0: 1
1: 0
2: 1
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995523864 Original CRISPR CTGCCATTGTCACCACACCC AGG Intronic
901688794 1:10959449-10959471 CAGCCAGTGCCACCCCACCCAGG + Intronic
901703534 1:11058138-11058160 CTACCACTGTCCCCATACCCGGG + Intronic
904035339 1:27555943-27555965 CTCCCCTCCTCACCACACCCCGG + Intronic
905542711 1:38772849-38772871 CTGGCATTGCCACCTCAGCCTGG - Intergenic
907537048 1:55172373-55172395 ATACCATTGTAAGCACACCCAGG + Exonic
910265385 1:85332531-85332553 CTGCCTTGTTCACCACAGCCTGG + Intronic
911428840 1:97757322-97757344 CTTCCACTGTCTCCTCACCCTGG - Intronic
914196541 1:145450824-145450846 CAGCCACTGTGACCTCACCCCGG + Intergenic
917826030 1:178821392-178821414 CTGGCATTGTCCCCAAACTCTGG - Intronic
918074360 1:181159279-181159301 AGGCCATTGTCCCCACACCCTGG + Intergenic
918558495 1:185834716-185834738 CTGCAATTATCCCCACATCCTGG - Intronic
919556256 1:199057710-199057732 CTGCAATTGGCAACACTCCCAGG + Intergenic
922603480 1:226874216-226874238 CTGCCTGTGTGACCAAACCCTGG + Intronic
923011094 1:230088247-230088269 CTCCCATTCTCACCAGCCCCTGG + Intronic
924875972 1:248105082-248105104 CTCCCCTTGCCACCACTCCCTGG + Intergenic
1065673099 10:28144032-28144054 CTGCCACCGCCACCATACCCGGG + Intronic
1066200671 10:33140507-33140529 CTGCCATAGTCCCAGCACCCAGG + Intergenic
1071477656 10:86038575-86038597 CTGCCAGTGAAACCATACCCTGG + Intronic
1073224078 10:101901671-101901693 CTGCCACAGTATCCACACCCAGG - Intronic
1073418173 10:103402197-103402219 CTGCCATTGTCTCCACTAGCTGG + Intronic
1074464732 10:113671171-113671193 ATGCCATTCTCACCACCCACAGG - Intergenic
1075719220 10:124575240-124575262 CTGCCCTTCTCAGCACACCAGGG - Intronic
1076676211 10:132148994-132149016 CTGCCACTGTCCCCACAGGCAGG - Intronic
1077322808 11:1949861-1949883 CTGCCACTGCCGGCACACCCTGG - Intronic
1083589315 11:63883726-63883748 AGGCACTTGTCACCACACCCCGG + Intronic
1084068333 11:66718370-66718392 CGGCCACTCTCCCCACACCCAGG + Intronic
1084868665 11:72080794-72080816 CTGCTTTCGTCACCACAACCCGG - Exonic
1088706133 11:112466250-112466272 CTGTCATTGTGACCAACCCCTGG + Intergenic
1091205340 11:133817177-133817199 CTTCCTTTGTGACCACAGCCGGG - Intergenic
1202805826 11_KI270721v1_random:5174-5196 CTGCCACTGCCGGCACACCCTGG - Intergenic
1093981121 12:25476966-25476988 GGGCCATTATCACCACACCAAGG + Intronic
1094008732 12:25784168-25784190 CTGCCTCTCTCACCACACACAGG + Intergenic
1096486394 12:51984681-51984703 CTGCCATTGTGACAAGATCCAGG - Intronic
1096532888 12:52253109-52253131 TTGCCCTTGTCCCCACACACTGG + Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097214515 12:57399905-57399927 CTGACATTCTCACCTCACCTAGG + Intronic
1097559847 12:61189297-61189319 ATGGCATTGTTACCATACCCTGG - Intergenic
1100329454 12:93570747-93570769 CTGCCTCTGGCCCCACACCCCGG - Intronic
1100865250 12:98850839-98850861 CTCCCATTTTCACAGCACCCAGG + Intronic
1103046535 12:117739689-117739711 CTGTCTTTGCCACCAGACCCAGG - Intronic
1103587110 12:121964013-121964035 CTGCCACTGCCACCACCACCAGG + Intronic
1104022574 12:125003234-125003256 AGGCCATTGTCACCCAACCCCGG + Intronic
1110294679 13:73849840-73849862 CAGCTATAGTCACCACTCCCAGG - Intronic
1115628705 14:35221554-35221576 GTGCCTTAGTCACCTCACCCTGG + Intronic
1117959044 14:61145201-61145223 CTGCCATTAGCACCTCACCATGG + Intergenic
1118492943 14:66279469-66279491 ATGACATTGTCACCACATTCAGG - Intergenic
1118817836 14:69325267-69325289 CTCCCATTTTTACCACTCCCGGG - Intronic
1118898025 14:69963273-69963295 CTGACATTGTCTCCAAACCTAGG - Intronic
1120073646 14:80131561-80131583 CTGCCATTGTCACCAGTAACTGG - Intergenic
1120993794 14:90399614-90399636 CTGCCACTGCCATCACAGCCAGG - Intronic
1122281946 14:100628843-100628865 CTGCCATTGTCCCCACTGGCTGG + Intergenic
1122411719 14:101529089-101529111 CTGCCATGCTCCCCACCCCCGGG - Intergenic
1122741164 14:103872243-103872265 TTGCCATTGTCACCAAGTCCAGG - Intergenic
1125767663 15:42146101-42146123 CTTCCTTCGTCTCCACACCCAGG + Intronic
1127288363 15:57549515-57549537 CTGTCATCCTCACCACAGCCAGG + Exonic
1128054558 15:64690009-64690031 CTCCCATTCACACCCCACCCAGG - Intronic
1128331772 15:66760848-66760870 CTGCCCTTGTCATCCCTCCCTGG + Intronic
1130995736 15:88902975-88902997 CAGGCATTGTCAACACACCCTGG - Intronic
1132375593 15:101326446-101326468 CAGCCTTTGTCACCACACTCCGG + Exonic
1135130376 16:19848965-19848987 TTGTCACTGTCACCCCACCCTGG + Intronic
1136355697 16:29744032-29744054 CTGGCATTGGCTCCACCCCCAGG + Exonic
1137704698 16:50526537-50526559 CCGCCATTTCCACCACACCTGGG - Intergenic
1138537602 16:57668135-57668157 CTCCCAGTCTCACCGCACCCTGG - Intergenic
1140043896 16:71426906-71426928 CTGCTATTGTCCCCTCTCCCAGG + Intergenic
1141560907 16:84867259-84867281 GTGGCATTTTCCCCACACCCAGG + Intronic
1141644761 16:85361531-85361553 CTGCCATGGTGGCCCCACCCTGG + Intergenic
1144767600 17:17741048-17741070 CTAACATGGTCACCACACTCCGG - Intronic
1145011344 17:19370066-19370088 CTAGAGTTGTCACCACACCCTGG + Intronic
1146688292 17:34856526-34856548 CTCCCATTTTCCCCACCCCCTGG - Intergenic
1148643269 17:49204145-49204167 CTGTGATTGTTACCACACCCTGG + Intronic
1148907442 17:50920173-50920195 CTGCCTTTTTCACAACACCCAGG - Intergenic
1149310857 17:55391657-55391679 CTGCCTTTCTCACAACTCCCTGG - Intergenic
1156830632 18:41486798-41486820 CTCCCATTGTCCCCAGGCCCAGG + Intergenic
1157774674 18:50383177-50383199 CTGTCATTGCCACCACACCTAGG + Intronic
1158365894 18:56735302-56735324 CTGCCATTCTCCCCTCAGCCGGG - Intronic
1158607175 18:58906018-58906040 GTGCCATTCTCATCACAGCCCGG + Intronic
1160135751 18:76270109-76270131 CTCCCATTATCACCACTACCCGG + Intergenic
1160401233 18:78612847-78612869 CTGACACTGCCACCAGACCCTGG - Intergenic
1160684447 19:426995-427017 CTGCCCCTGTGCCCACACCCGGG - Intronic
1160916981 19:1501480-1501502 CTGCCCAGGTCAGCACACCCAGG + Intergenic
1160938845 19:1610554-1610576 CTGGCATGGGGACCACACCCTGG - Exonic
1161024389 19:2028894-2028916 CTGCCATTGTCACTAACCACAGG - Intronic
1161562041 19:4978821-4978843 CTGTCACTGTAGCCACACCCTGG + Intronic
1161898202 19:7098742-7098764 GTGCCAGTGTCTCCACATCCTGG - Intergenic
1163145803 19:15378954-15378976 CTGCCAATGTCACCAGCCCCAGG + Intronic
1163747228 19:19055711-19055733 CTGCCATGGCCACCAACCCCTGG - Intronic
1164309506 19:24033680-24033702 CTGCCTTCGTCACCGCTCCCGGG + Intronic
1164715402 19:30387212-30387234 CTGCCTTTCTCCCCACATCCAGG - Intronic
1164777967 19:30869026-30869048 CTGCCTAAGTCTCCACACCCAGG + Intergenic
1165158968 19:33804772-33804794 GTGCCATTGTCACCAGGCCTAGG + Intronic
925292231 2:2755658-2755680 CTGGTATTGCCACCACACACAGG + Intergenic
925811139 2:7702119-7702141 CTGCCATTTTTGCCAAACCCAGG + Intergenic
928179295 2:29056678-29056700 CAGTCATCGTCACCACAGCCAGG - Exonic
929026540 2:37609850-37609872 CAGCCATTGTCCTTACACCCTGG - Intergenic
929312035 2:40436516-40436538 CTGACATTTTCCCCACAACCTGG + Intronic
929665173 2:43828229-43828251 CTTCCAGACTCACCACACCCTGG + Intronic
929932670 2:46271043-46271065 CTGCCGCTGTCACCACACCCAGG - Intergenic
933773905 2:85760317-85760339 CAGCCATTGTCGGCTCACCCTGG - Intronic
935142744 2:100368313-100368335 TTGCCATTGTCCCTACCCCCAGG + Intergenic
936244699 2:110816613-110816635 CTGACAATGTCATCAGACCCAGG - Intronic
937779588 2:125822188-125822210 CTCCAATTGTAACCAGACCCAGG + Intergenic
941490900 2:166141105-166141127 CTGCCCTGCTCACCACTCCCCGG + Intergenic
941674506 2:168329179-168329201 CTGTCATTGTCACACCATCCTGG + Intergenic
943900730 2:193432526-193432548 AGGCCAGTGCCACCACACCCCGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
946183833 2:217965686-217965708 CTGCCAGGCTCACCACACCCCGG + Intronic
947004592 2:225496283-225496305 CTGTCATAGCCACCACACTCAGG - Intronic
948320216 2:237062832-237062854 CTGCCATTGTGAGCTCAGCCGGG - Intergenic
948533539 2:238629628-238629650 TTGGCATTGTAACCACAGCCTGG + Intergenic
1170519136 20:17165787-17165809 CTGCCTGTGTAACCAAACCCAGG + Intergenic
1172090816 20:32431133-32431155 CTGTCATTGCCATCAAACCCAGG - Intronic
1173657598 20:44711235-44711257 ATGCCTCTGTCACCTCACCCTGG + Intergenic
1174351179 20:49969428-49969450 CTTCAAGTGTAACCACACCCAGG - Intergenic
1176425956 21:6548302-6548324 CTGCTGCTGTCACCACACCAGGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179317549 21:40257824-40257846 TTGTCATTGTCATCACACCATGG - Intronic
1179682176 21:43030531-43030553 GTGCCGTTGTCACCGCACACTGG - Exonic
1179701447 21:43156619-43156641 CTGCTGCTGTCACCACACCAGGG - Intergenic
1181684300 22:24517735-24517757 CTGCCAGCCTCACCACACCCTGG - Intronic
1181855675 22:25779988-25780010 CTGCCACTGCCACCTCACACAGG - Intronic
1181984493 22:26790051-26790073 CTGCCTTTCTCACCTAACCCAGG - Intergenic
1182277520 22:29200111-29200133 CTCCCACTGTCCCCAGACCCTGG - Intergenic
1183032167 22:35114431-35114453 CTTTCATGGTCACCAAACCCAGG - Intergenic
1184474186 22:44711750-44711772 TGGCCACTGTCCCCACACCCTGG - Intronic
1184526925 22:45029540-45029562 CTGCCTTTGTCACCTCCACCCGG + Intergenic
953197742 3:40750275-40750297 CTGCCACTGTTACCCCACACGGG - Intergenic
954717022 3:52532021-52532043 CTCCCAATGTCACCACACTGAGG + Intronic
955824296 3:62928953-62928975 CTCCAGTTGCCACCACACCCTGG - Intergenic
959743927 3:109754060-109754082 GTGCCACTGACACCACACCTGGG - Intergenic
962805973 3:138928218-138928240 CTGCCTATTTCTCCACACCCTGG + Intergenic
967080421 3:186044592-186044614 CTGCCAAGGTCAACAAACCCAGG + Intergenic
968641346 4:1716600-1716622 CTCCCATTGCCACCCCACCCAGG + Exonic
971125239 4:23746874-23746896 CTCCACTTGTTACCACACCCTGG - Intergenic
971227545 4:24769004-24769026 CTGCCATTATTCCCACACCTAGG + Intergenic
977904275 4:102457534-102457556 CTTCCAATCTCTCCACACCCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981919215 4:150068400-150068422 GTGCCCTTCTCACCTCACCCAGG - Intergenic
982985083 4:162196897-162196919 CTGCCAACATCGCCACACCCAGG - Intergenic
984229177 4:177073600-177073622 CTGTCATTATCACCCAACCCTGG - Intergenic
985084805 4:186301509-186301531 CCTCCAATGTCACCACATCCTGG + Intergenic
985504548 5:271609-271631 CTGGCATTATCACCACTTCCGGG - Exonic
986659692 5:10047906-10047928 CTGGCATTGTTACCATGCCCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
989466778 5:41765652-41765674 CTGACATAGTCACCTCACTCAGG - Intronic
990759325 5:59110998-59111020 CTGTCAATGCCTCCACACCCAGG + Intronic
992672947 5:79077732-79077754 CTGCCATTATCTCCACATCTTGG - Intronic
995523864 5:113035312-113035334 CTGCCATTGTCACCACACCCAGG + Intronic
997296143 5:132769821-132769843 CTGCCATTCCCACCTCTCCCCGG - Intronic
997590519 5:135069312-135069334 CTGCCGTTCTCTCCACAGCCAGG - Intronic
999150103 5:149421180-149421202 CTTCCCTTCTCAGCACACCCAGG - Intergenic
1001300711 5:170531735-170531757 CCCCCATTGTCAGCACTCCCTGG - Intronic
1004913937 6:20313753-20313775 ATGCCACTGTAACCACACACAGG + Intergenic
1006845727 6:37060025-37060047 CTGCCCCTGTCACCAGGCCCTGG - Intergenic
1007435062 6:41804789-41804811 GTGCCATTGGCACTACAGCCTGG - Intronic
1007498743 6:42279692-42279714 CTGGCGCTGTCACCACATCCTGG + Intronic
1007747429 6:44051562-44051584 CAGCCCATGTCACCCCACCCTGG - Intergenic
1009888394 6:69652259-69652281 CTGCCACTGTAACCAAACCTAGG - Intergenic
1011753849 6:90479386-90479408 CTGACAGTGACACCACACCCTGG + Intergenic
1015739366 6:136437113-136437135 CTGCCCTTCTCAGCACTCCCTGG + Intronic
1018085293 6:160296256-160296278 GTGACCTTTTCACCACACCCTGG - Intergenic
1019140690 6:169940513-169940535 GTGCCATTGTCATCACAGCCTGG - Intergenic
1019655204 7:2189944-2189966 CAGCCATTCTCACCATGCCCAGG + Intronic
1020514257 7:9096574-9096596 CTGCCTTCCTCACCACACTCTGG + Intergenic
1022523569 7:31023094-31023116 CTGCCATTGTCAGCACCCCTTGG + Intergenic
1022599888 7:31747786-31747808 CTGACCCTGTGACCACACCCAGG - Intergenic
1029275450 7:99401300-99401322 CTGCCATTGTCACCATCCTAGGG + Intronic
1035031090 7:155861161-155861183 CTGACATCGTCTCCTCACCCAGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037727158 8:21492240-21492262 CTGCCCTTTTCCCCACAGCCAGG - Intergenic
1040423154 8:47259689-47259711 CTGCCATTGCCACCTCCGCCGGG - Intergenic
1042811531 8:72830765-72830787 ATGCCATTTTAACCTCACCCAGG + Intronic
1043277595 8:78419326-78419348 CTGTTCTTGTCTCCACACCCAGG + Intergenic
1043687955 8:83111913-83111935 CTGCTATGGCCCCCACACCCAGG + Intergenic
1043694297 8:83201110-83201132 CTGCCATAGACACCAGGCCCAGG + Intergenic
1044742040 8:95337402-95337424 CTGGCATTGTTAGCACATCCTGG + Intergenic
1045063410 8:98426763-98426785 CTGTTATTATCACCACCCCCAGG - Intronic
1047190971 8:122678982-122679004 CTGCCATGATCACCGCAGCCCGG + Intergenic
1047371607 8:124260586-124260608 CTTCAATTGTCCCGACACCCAGG + Intergenic
1048508538 8:135042234-135042256 CTGTCATTGTCACCCCAGCCTGG + Intergenic
1049159785 8:141089788-141089810 CTGTCATTCCCACCCCACCCTGG + Intergenic
1049256570 8:141617270-141617292 GCGCCTTTGTCTCCACACCCTGG + Intergenic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1049286892 8:141780751-141780773 CCCACATTGTCACCACAGCCAGG + Intergenic
1049383655 8:142330249-142330271 GTGCCACTCTAACCACACCCAGG + Intronic
1050735374 9:8756307-8756329 TTGTCATTGTCCCCACCCCCGGG + Intronic
1051175151 9:14353087-14353109 CTGCCATTCTCACCAACCCATGG - Intronic
1053529963 9:38870759-38870781 CTCCCACAGTCACCACACTCTGG - Intergenic
1054202188 9:62095186-62095208 CTCCCACAGTCACCACACTCTGG - Intergenic
1054636169 9:67493174-67493196 CTCCCACAGTCACCACACTCTGG + Intergenic
1055931976 9:81568251-81568273 ATGCCTTAGTCACCTCACCCTGG - Intergenic
1056121142 9:83490331-83490353 GTGCCATTGGCACTCCACCCTGG - Intronic
1056817611 9:89812876-89812898 CCGCCATGGTCACCTTACCCCGG - Intergenic
1058709243 9:107665188-107665210 CTGCGTTTCTAACCACACCCAGG + Intergenic
1059801755 9:117756772-117756794 CTGTCATTGTCACCCCACTTTGG + Intergenic
1061318593 9:129813809-129813831 CTGGCATTGTTTCCACCCCCTGG - Exonic
1062686652 9:137817072-137817094 CTGCAGGTGTCACCACAGCCTGG + Intronic
1062698191 9:137886010-137886032 CAGCCACTGTGACCTCACCCCGG - Intronic
1186730871 X:12408122-12408144 ATGCCATTATCTCCAGACCCAGG + Intronic
1190759985 X:53431156-53431178 CTGCCTTTCCCACCCCACCCTGG + Intergenic
1192343440 X:70282108-70282130 CGGCCATTGGCTTCACACCCAGG - Intronic
1201753468 Y:17460171-17460193 CTGGCATTGTGGCCACACCTTGG - Intergenic
1201848085 Y:18445812-18445834 CTGGCATTGTGGCCACACCTTGG + Intergenic