ID: 995524134

View in Genome Browser
Species Human (GRCh38)
Location 5:113037323-113037345
Sequence TGAACTCTGAGGAGTCTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995524134 Original CRISPR TGAACTCTGAGGAGTCTCGC TGG Intronic
901629594 1:10641669-10641691 TCTACTCTGAGGAGTCCCCCTGG - Intronic
906150973 1:43587627-43587649 TGGTCTCTGAGGACCCTCGCTGG - Intronic
906193505 1:43914349-43914371 GGAGCTCTCAGGAGTCTCTCTGG - Intronic
912196601 1:107404465-107404487 TGAACTCTGAGAAATCTCAGTGG + Intronic
919135232 1:193499254-193499276 TGAATTCTGAGGATTTTCTCTGG + Intergenic
919975266 1:202606517-202606539 AGAGAGCTGAGGAGTCTCGCGGG - Intronic
923057860 1:230441306-230441328 TGAACTTTTAGGATTCTCCCTGG - Intergenic
924928390 1:248705603-248705625 TGACCTCTGAGGTGGCTTGCAGG + Intergenic
1064516379 10:16153615-16153637 TGAACTCTGGGGACTCTGGAAGG - Intergenic
1084457075 11:69274009-69274031 TGAACTTGGAGCCGTCTCGCGGG + Intergenic
1087969872 11:104467106-104467128 TGGACTCTGAGGACTCTGGGTGG + Intergenic
1090225136 11:125065829-125065851 TGAATTCTGAGGAGTCAGGTAGG + Intronic
1104111611 12:125710024-125710046 TGAACTCTGAGCAATCTTGGGGG + Intergenic
1104168179 12:126254092-126254114 AGAACTCTCAAGAGTCTCTCTGG - Intergenic
1106245168 13:27943434-27943456 TGAACTCTGGGGAGTCCGACTGG + Intergenic
1112813251 13:103243552-103243574 GGAACTCTTAGGAGTCTTCCAGG - Intergenic
1119599854 14:75968264-75968286 TGAACTCTGAAGAGACTCATGGG + Intronic
1122290150 14:100676410-100676432 TGGACTCTGAAGAGGCTCCCTGG + Intergenic
1122998429 14:105278114-105278136 GGAAGTCTAAGGAGACTCGCAGG - Intronic
1125682876 15:41543883-41543905 TGGCCTCTGAGGAGTCTCTGGGG + Intronic
1132035346 15:98479071-98479093 TGACCACTGATGAGTCTCCCAGG + Intronic
1135720215 16:24810985-24811007 TGACCTCTGAGGGGTCTGTCTGG - Intronic
1140020971 16:71238207-71238229 TGAACTCAAAGGAGTGTCTCAGG + Intergenic
1141901650 16:86995039-86995061 TGAGCTCTAAGCAGTCACGCTGG + Intergenic
1145401039 17:22533237-22533259 TAAAATCTGAGGGCTCTCGCTGG + Intergenic
1146419119 17:32665883-32665905 TTCACTCTGAGGATTCTGGCAGG - Intronic
1146529118 17:33592865-33592887 TGGATTCTGAAGAGTCTCTCAGG - Intronic
1146610613 17:34301907-34301929 TGAAATCTGAGCAGTCTAGTAGG + Intergenic
1149645990 17:58242059-58242081 TGAAAGCTGAGGAGCCTCTCAGG + Intronic
1150414941 17:64979522-64979544 TGAACTCTGTGGTGTCAGGCTGG - Intergenic
1150784507 17:68151696-68151718 TGAACTCTGATGAGCCTCTAGGG - Intergenic
1150796696 17:68244147-68244169 TGAACTCTGTGGTGTCAGGCTGG + Intergenic
1151460310 17:74250288-74250310 TGGACTCTGAGGAGTTCAGCAGG - Exonic
1160280606 18:77486298-77486320 TGAGCTCTGGGGAGTCTCTAGGG + Intergenic
1160621999 18:80178315-80178337 TGAGCTCGGAGGAATCTGGCTGG - Intronic
1161726263 19:5931029-5931051 TGCACTCTGAGGAGTCACTAGGG - Intronic
1162824524 19:13243472-13243494 TGTACTCTCAGGAGTCACCCAGG + Intronic
1168366937 19:55796401-55796423 TGAACTCTGAGGAGTGGCATAGG - Intronic
925131428 2:1496640-1496662 TGCACTGTGAGGAGTCTGGGAGG + Exonic
925153572 2:1634178-1634200 CAAACTCTGAGGAGCCTCCCAGG + Exonic
925364326 2:3301381-3301403 TGAACACTGAGGAGTCTCCCAGG + Intronic
925364344 2:3301478-3301500 TGAACACTGAGGAGTCTCCCAGG + Intronic
931483201 2:62664185-62664207 TGAGCTCTGAAGAGTTTCTCTGG + Intergenic
932779520 2:74551234-74551256 TGAACCCTGTGGAGTATCACTGG + Intronic
935061344 2:99610738-99610760 TGGACTCTGATGAGTCTGGGTGG + Intronic
937566594 2:123297768-123297790 TGAACAATGAGGAATCTCTCAGG + Intergenic
943266819 2:185741890-185741912 TGAACACTATGGAGTCTGGCTGG - Intronic
945711202 2:213297602-213297624 TGAACTCTGATTAATCTCACTGG + Intronic
946305327 2:218853779-218853801 TGACCTCTCAGGAGTGTGGCTGG + Intergenic
947711370 2:232318285-232318307 TGAACTCTGAGGACTTTCCTAGG - Intronic
948246388 2:236489488-236489510 TGAACTCTGAGCAGGCTCAATGG + Intronic
1168817021 20:744920-744942 TGACCTCTGAGCACTCTCACAGG - Intergenic
1169560414 20:6793879-6793901 TGAACTCAGAGGAGACTCTTAGG + Intergenic
1181169643 22:21000938-21000960 TGGACTGTGAGGAGTCCTGCGGG - Intronic
949234790 3:1795192-1795214 TGATCTCTGAGGAGGATCTCTGG + Intergenic
949486813 3:4547665-4547687 TGATCTGTTAGGAGTCTCGTAGG + Intronic
951091619 3:18580091-18580113 TGAACGCTGAGCTGTCACGCAGG - Intergenic
954628289 3:52034815-52034837 TGAAATCTGAGCAGACTCCCTGG + Intergenic
954712287 3:52511181-52511203 TGAGAGCTGAGGGGTCTCGCTGG + Intronic
958560061 3:95736816-95736838 TCAACTCCGAGGAGCCTCGTTGG + Intergenic
961787189 3:129354221-129354243 AGCACTCTGAGGAGTCTTGTGGG + Intergenic
962020796 3:131499493-131499515 TGAACTCTGAAGAAACTGGCGGG - Intronic
970736728 4:19179220-19179242 TGGACCCTGAGCAGTCTCTCAGG - Intergenic
974547726 4:63334301-63334323 TGAACCCTGAGTAGCCTAGCTGG + Intergenic
990486493 5:56264411-56264433 TGAACACTGAGGAAGCTCTCAGG - Intergenic
995524134 5:113037323-113037345 TGAACTCTGAGGAGTCTCGCTGG + Intronic
998847642 5:146326433-146326455 TGCACTCTGATGTGTCTCACTGG + Intronic
1000144827 5:158444224-158444246 TGAACTCTGAGTAGCCTAACTGG - Intergenic
1002602799 5:180363587-180363609 TCATCTCAGAGGAGTCTTGCTGG + Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1006595710 6:35191546-35191568 TGAATTCTGAAGACTCTCCCAGG - Intergenic
1011205416 6:84889465-84889487 TGAACCCTAAGGACTCTCCCTGG - Intergenic
1014464462 6:121738583-121738605 TTAGCTCTGAAGAGTCTGGCTGG - Intergenic
1016220588 6:141665526-141665548 TGAACTCTGAGTGGTCTCTGCGG + Intergenic
1018859940 6:167704143-167704165 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859959 6:167704227-167704249 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859969 6:167704269-167704291 AGAGCTTTGAGGAGTCTCTCCGG - Intergenic
1018859989 6:167704374-167704396 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018859994 6:167704395-167704417 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018860004 6:167704437-167704459 GGAACTGGGAGGAGTCTCTCCGG - Intergenic
1018860009 6:167704458-167704480 AGAACTGGGAGGAGTCTCTCCGG - Intergenic
1025809937 7:64869333-64869355 TGCACTTTGAGGAGGCTCTCGGG + Intergenic
1025852145 7:65252260-65252282 TGACCACTGAGGAGTCGCGCTGG + Intergenic
1028985135 7:97003512-97003534 GGAACTCGGAGGAAACTCGCGGG + Intergenic
1030433470 7:109483622-109483644 AGACCTGTGAGGAGTCTCTCAGG + Intergenic
1030478583 7:110072223-110072245 TGAACTCTGAGTAGTTTCTAAGG - Intergenic
1035902728 8:3475139-3475161 AAGACTCTGAGGATTCTCGCTGG + Intronic
1040273581 8:45985447-45985469 TGAACTCTGAGCAGCCTAACTGG - Intergenic
1040886299 8:52267169-52267191 TGAACCCTGAGGGGTTTAGCAGG + Intronic
1045174736 8:99710418-99710440 TGAACTCTGAGTATTCTCTGTGG + Intronic
1056248085 9:84718605-84718627 TGCACTCTGGGGAACCTCGCTGG - Intronic
1056692364 9:88818797-88818819 TGTGCTCTGAGCAGACTCGCAGG - Intergenic
1061880482 9:133566520-133566542 TGACCTCTGAGGAGGCTGACGGG + Intronic
1189268518 X:39734429-39734451 TGACCTCTCAGGAGTGTTGCAGG + Intergenic
1190570805 X:51779415-51779437 AGAACTCTGAGAAATCTCCCAGG - Intergenic
1195496055 X:105535135-105535157 TGAATTCTGAGAAGTCTTTCTGG - Intronic
1198703958 X:139427160-139427182 TGGACTCTGTGGAGTCAAGCAGG - Intergenic
1199612985 X:149633445-149633467 TGGACTCTGAGGAGCCTGCCTGG - Intergenic
1200012883 X:153133229-153133251 TGAACTCAAAGGAATGTCGCAGG - Intergenic
1200026718 X:153266688-153266710 TGAACTCAAAGGAATGTCGCAGG + Intergenic
1200162278 X:154015732-154015754 GGAACTCAGAGGACTCTGGCCGG - Intronic