ID: 995528536

View in Genome Browser
Species Human (GRCh38)
Location 5:113070052-113070074
Sequence GCTCAAAGGCAGATTGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995528531_995528536 13 Left 995528531 5:113070016-113070038 CCATGAGGTTGTACTAATGTGGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 995528536 5:113070052-113070074 GCTCAAAGGCAGATTGTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 212
995528529_995528536 19 Left 995528529 5:113070010-113070032 CCTTATCCATGAGGTTGTACTAA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 995528536 5:113070052-113070074 GCTCAAAGGCAGATTGTGGGTGG 0: 1
1: 0
2: 0
3: 10
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995528536 Original CRISPR GCTCAAAGGCAGATTGTGGG TGG Intronic
900338094 1:2174675-2174697 GCTCAGAGTCAGAGTCTGGGCGG + Intronic
902269003 1:15289580-15289602 GCTCACAGGCCGCCTGTGGGAGG - Exonic
903170698 1:21551176-21551198 GCCCTAAGGAAGGTTGTGGGGGG - Intronic
903475450 1:23616278-23616300 GGTCAAAGGCAAATTCTGGAAGG - Intronic
903976094 1:27151175-27151197 GCTCAGAGGAAGGTTGTAGGAGG + Intronic
904382551 1:30121121-30121143 GCTAAAAGGCAGGGAGTGGGTGG + Intergenic
907033825 1:51198701-51198723 GCTTAAAGGCATATTGTAGCTGG + Intergenic
908340756 1:63176281-63176303 GCTCAAGGGAAGGTTGTGGCTGG + Intergenic
908358507 1:63345229-63345251 GCTCAAAGGCACATGGTAGTGGG - Intergenic
909435901 1:75641948-75641970 CCAGAAAGGCAGATTGTGGTTGG - Intergenic
910446452 1:87303169-87303191 GCTCAGTGGCAGGTTGTGGGAGG - Intergenic
910678231 1:89836497-89836519 GCTCAAAGGCTGAGTTTAGGAGG - Intronic
912988245 1:114456615-114456637 ACTCAAAGGCAAATTGTGGTTGG - Intronic
914450455 1:147786952-147786974 GCTCAAAGGCAGAGCATGGCAGG + Intergenic
915318852 1:155044935-155044957 GCTCAGAGCCAGCTTGTGGAGGG + Intronic
915321666 1:155059967-155059989 GCTCAAAGGTAGCATGGGGGTGG + Exonic
916956859 1:169846722-169846744 GCTTAAAGGAATATTGTGGCTGG + Intronic
918524274 1:185448221-185448243 GGCCAAAGCCAGAATGTGGGTGG + Intergenic
918760950 1:188406389-188406411 GCCCAAAGGCATAATGTGGAAGG - Intergenic
919578021 1:199336623-199336645 GCTCAACTGCAGCTTGTTGGAGG - Intergenic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1064803751 10:19107917-19107939 AGTCAAAGACAAATTGTGGGAGG - Intronic
1064874203 10:19974875-19974897 TCTCAAAGGCAGCTTGTTGAAGG + Intronic
1066412632 10:35188476-35188498 GATCGAAGGTAGATGGTGGGGGG + Intronic
1067958121 10:50816116-50816138 GCTCCAAGGTAGGTTGTGGTGGG + Exonic
1069965158 10:72109181-72109203 GGTCAAGGGCAGTCTGTGGGAGG + Intronic
1072100682 10:92226738-92226760 CATCAAAGGCATATTGAGGGAGG + Intronic
1072292438 10:93976591-93976613 GCTCAAAGAGAGAATCTGGGTGG + Intergenic
1072473991 10:95740920-95740942 GCTCAAAGGAATGTTGTGGCTGG + Intronic
1073982340 10:109168936-109168958 GTTCAAAGGCAGACTGCTGGTGG - Intergenic
1075140140 10:119826064-119826086 GCTCAAATTCAGATAGTGGGGGG - Intronic
1075202461 10:120416348-120416370 GCTCAAAGCCAAATGGTGGAGGG + Intergenic
1077284346 11:1759155-1759177 GCTCCATGGTAGATTGTAGGGGG - Intronic
1077642087 11:3890544-3890566 GCTCAAAAGGATATTGTGGCCGG + Intronic
1079321785 11:19457490-19457512 GGGCAAAGCCAGATTGTGGAGGG + Intronic
1079561956 11:21832596-21832618 GCTCAAAGGCAGTTTTTCTGTGG - Intergenic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1083675321 11:64321900-64321922 GCTGAAAGGGAGAATGTAGGGGG + Intergenic
1083816827 11:65137547-65137569 CCTGAAGGGCAGAGTGTGGGAGG - Intergenic
1086737387 11:90323020-90323042 GCCCAAAGGCAACTTTTGGGTGG + Intergenic
1088995894 11:114996478-114996500 GCTAAAAGGCACCTTGTGAGAGG + Intergenic
1093838684 12:23868947-23868969 GATGAAGGGCAGATTCTGGGGGG - Intronic
1094717523 12:33027930-33027952 ACTAAAAGGCAGAGTGTGGCAGG + Intergenic
1097051938 12:56229000-56229022 TCTCAGAGGCTAATTGTGGGAGG - Exonic
1099131906 12:78843327-78843349 GCTTAAAGGAATGTTGTGGGTGG - Intergenic
1102744282 12:115236518-115236540 GCTCAAAGTCATATAGTGAGTGG + Intergenic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1104392483 12:128402637-128402659 GTTCCAAGCCACATTGTGGGTGG + Intronic
1106669379 13:31888526-31888548 GCTCCAAGGCAGATGCTGGTGGG - Intergenic
1112591064 13:100763303-100763325 GCTCAAAGGCAACTGGTGGAGGG + Intergenic
1113555149 13:111227873-111227895 GAGTAAAGGCAGAATGTGGGAGG - Intronic
1113758682 13:112832728-112832750 CCACGAAGGCAGCTTGTGGGCGG - Intronic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1114527638 14:23376672-23376694 GGACAAAGGCGGATTGTTGGGGG - Intergenic
1115706971 14:36008854-36008876 GATCATAGGCAGGTTGTGTGGGG - Intergenic
1117882493 14:60325957-60325979 GTTAAAATGCAGATTGTGGCCGG - Intergenic
1119429359 14:74555763-74555785 GTGCAAAGGCAGAGAGTGGGTGG - Intronic
1120153227 14:81061633-81061655 GCTTGAAGGCAGAGGGTGGGAGG + Intronic
1120978710 14:90272660-90272682 GCTCAACAGCAGCCTGTGGGTGG + Exonic
1122035879 14:98949172-98949194 GGTCAAGGGCACATTGTGGGTGG - Intergenic
1122037140 14:98957140-98957162 GTTCATCTGCAGATTGTGGGGGG + Intergenic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1122413578 14:101538134-101538156 GCTCTCAGGCAGGTTGTAGGAGG - Intergenic
1126456204 15:48864881-48864903 GACCAGAGACAGATTGTGGGGGG - Intronic
1129389809 15:75214866-75214888 GGACAAAGGCAGGGTGTGGGAGG - Intergenic
1129463202 15:75710191-75710213 ACTGAAAGGCAGAATGTGAGGGG - Intronic
1129721683 15:77881210-77881232 ACTGAAAGGCAGAATGTGAGGGG + Intergenic
1130933165 15:88447031-88447053 GCACAAAGGAACTTTGTGGGTGG + Intergenic
1131058321 15:89389650-89389672 GCTCCAAGCCAGGTTGAGGGGGG + Intergenic
1133640991 16:7717197-7717219 GCTTTAAGGCAGATTTTTGGAGG - Intergenic
1135465869 16:22684356-22684378 GCTCAAAAGCAGTGTCTGGGTGG + Intergenic
1137846972 16:51699475-51699497 GCTCAGATTCAGATTCTGGGTGG + Intergenic
1139821295 16:69723498-69723520 GATCAAAAGAAGGTTGTGGGTGG + Intronic
1141259455 16:82439649-82439671 TTTCACAGGCAGGTTGTGGGTGG + Intergenic
1142158110 16:88542172-88542194 GCTCAGAGGCTGCATGTGGGTGG + Intergenic
1144213218 17:13032641-13032663 GTTAAAATGCAGATTGTGGCTGG + Intergenic
1145748721 17:27340086-27340108 GCTCAAAGGCAGTTTGGGTAAGG + Intergenic
1145786242 17:27595688-27595710 GGGCAAAGGGAGAATGTGGGGGG - Intronic
1146860060 17:36289612-36289634 GCTCCAAGACAGAATGTTGGGGG - Intronic
1147090386 17:38093703-38093725 GCTCCAAGACAGAATGTTGGGGG - Intergenic
1147106827 17:38226823-38226845 GCTCCAAGACAGAATGTTGGGGG + Intergenic
1148422704 17:47561713-47561735 GCTCCAAGACAGAATGTTGGGGG - Intronic
1148833006 17:50447904-50447926 GCTCAAAGGCTGATAGGGTGTGG + Intronic
1151339936 17:73464709-73464731 TCTCAAAGGAAGGTTGTTGGGGG - Intronic
1151519582 17:74618618-74618640 GAGGAAAGGCAGATGGTGGGAGG - Intronic
1156000769 18:32381711-32381733 TCTAAAAAGCAGATTCTGGGAGG + Intronic
1156385482 18:36600869-36600891 GCTCAAAGGAAGAATGTGCAGGG - Intronic
1157020785 18:43779030-43779052 GCTCAAAGCCAGAATCTGAGGGG - Intergenic
1160016066 18:75141667-75141689 GCTGAAATGAACATTGTGGGCGG - Intergenic
1160680165 19:408686-408708 GCTCAAAACCAGAGTGGGGGCGG - Intronic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
1166329093 19:42068567-42068589 GCTCAGAGGCAGAGAGAGGGAGG + Intronic
1166877915 19:45909112-45909134 GGTGAGAGGCAGATTGTGTGGGG + Intergenic
1167192796 19:48003413-48003435 ACTAAAAGGCAGATCGAGGGAGG + Intronic
925137202 2:1530106-1530128 GCGCATAGGGAGATTTTGGGAGG - Intronic
925137896 2:1532891-1532913 GCACATAGGGAGATTTTGGGAGG - Intronic
927515527 2:23669699-23669721 GCTCAGAGGCTGACTGGGGGTGG - Intronic
929585920 2:43114345-43114367 GCTTATAGGCAGGTGGTGGGAGG - Intergenic
929816806 2:45238894-45238916 GTCCAAAGGCAGATTGTTCGAGG - Intergenic
929894146 2:45943997-45944019 GTTCAAAGGCAGATAGATGGTGG + Intronic
930578493 2:53181686-53181708 GCTCACAGGGAGATTCAGGGAGG - Intergenic
932730971 2:74221818-74221840 CCTCAAAGACAGATTAGGGGTGG - Intronic
933414709 2:81971325-81971347 TCTCAAATTCAGATTGGGGGAGG - Intergenic
933581321 2:84129982-84130004 ACTCCAAGTCAGAATGTGGGTGG - Intergenic
934614942 2:95764912-95764934 GCTGAAACCCAGGTTGTGGGAGG + Intergenic
934645961 2:96059575-96059597 GCTGAAACCCAGGTTGTGGGAGG - Intergenic
934656699 2:96120122-96120144 GGTCAAAGGCAGGCAGTGGGTGG - Intergenic
934839364 2:97615665-97615687 GCTGAAACCCAGGTTGTGGGAGG - Intergenic
935099457 2:99978978-99979000 GATCAAAGGCAGGTGGTGGAAGG + Intronic
938509208 2:131922787-131922809 GCTCAATGGCAGAGTGGGGATGG - Intergenic
940545271 2:155075502-155075524 GCTGAAAGGCAGATCTTGGAGGG - Intergenic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
941914586 2:170802237-170802259 GCACTAAGGGAGAATGTGGGAGG + Intergenic
944757676 2:202780799-202780821 ACTCAAAGCCAGATTTTGTGTGG - Intronic
944811335 2:203329384-203329406 GCTCAAGGGCTGATAGTGGTAGG + Intronic
947202724 2:227629289-227629311 ACTCAAATGCAGGTTGTGTGTGG - Intronic
947271370 2:228339281-228339303 GCTTGAAGGTAGATTGTGTGTGG - Intergenic
1169231356 20:3890652-3890674 GTTTAAATGCAGATTGTGAGAGG + Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1173229417 20:41182549-41182571 GCTTAAAGGGACATTGTAGGAGG - Exonic
1173650332 20:44659703-44659725 GCTGGAAGGCAGATGGTGAGTGG - Intergenic
1174499055 20:50970848-50970870 GCTGGAAGGGAGATTGTGGAAGG - Intergenic
1174631268 20:51960234-51960256 GCACAAACCCAGATTGTGTGTGG + Intergenic
1174828009 20:53786462-53786484 ACCCAGAGGCAGATTATGGGAGG - Intergenic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175986691 20:62767726-62767748 GCTCAGAAGCAGATGGTGGCTGG - Intergenic
1177789188 21:25703683-25703705 GCTGAAAGGCCCAGTGTGGGTGG - Intronic
1177982326 21:27929614-27929636 GCTCAATGGCAGAGTGGGGATGG + Intergenic
1179586334 21:42376132-42376154 GCTCAAGGGCAGCTGGTGAGAGG + Intronic
1179956289 21:44740975-44740997 GCTCAAAGGCTGCATGTGGCAGG + Intergenic
1181107000 22:20581514-20581536 GCTCCTAGGCAGACTGTGAGGGG + Intronic
1183048943 22:35245233-35245255 GCTCAACGGCAGAATGGAGGTGG - Intergenic
1184275545 22:43407654-43407676 GCTCAGAGGCAGCATGTGAGGGG + Intergenic
1184974777 22:48053218-48053240 GTTCAGAGGTAAATTGTGGGAGG - Intergenic
1185246887 22:49777385-49777407 GCTCATTGCCAGATTCTGGGAGG + Intronic
949630712 3:5923378-5923400 GCTTAAGGGCAGATTGTGGCAGG + Intergenic
951441494 3:22728631-22728653 GCTAAAAGGCAGCTGGGGGGAGG - Intergenic
951526825 3:23661351-23661373 GCTCAAAGTCATATAGTGAGTGG + Intergenic
953610271 3:44442007-44442029 TCTCACAGGGTGATTGTGGGTGG - Exonic
955528512 3:59847348-59847370 ACTCAAAGGCAGATTTTGACAGG - Intronic
955876406 3:63494271-63494293 GCTCAAAAGCACATTGTTGGCGG - Intronic
957374421 3:79337287-79337309 ACTCAAAATGAGATTGTGGGTGG - Intronic
959773105 3:110123649-110123671 GCTTAAAGGAACATTGTGGCTGG - Intergenic
960187055 3:114656362-114656384 TCTTAACAGCAGATTGTGGGTGG - Intronic
960908331 3:122623515-122623537 GCCCACAGGTAGATTGTGGCAGG + Intronic
961105977 3:124241904-124241926 GCTCAAAGGAACACTGGGGGTGG + Intronic
962001230 3:131299522-131299544 GCTGAGAGGTAGATGGTGGGAGG - Intronic
964049864 3:152377596-152377618 GTTCAAAGGCAAATTGTTGATGG + Intronic
965901336 3:173644964-173644986 GCTCAGAGGCTGGTGGTGGGAGG + Intronic
966921762 3:184616599-184616621 GCTCACATGTAGATTGTGTGAGG + Intronic
967155955 3:186692416-186692438 ATTCAGAGGCAGATTGAGGGAGG - Intergenic
969054265 4:4391835-4391857 CCTAAAAGACAGTTTGTGGGTGG - Intronic
969460427 4:7326096-7326118 GCTCAGAGGCAGGTGGTGAGGGG + Intronic
969964238 4:10977754-10977776 GCCCACAGCCAGAATGTGGGGGG - Intergenic
971748346 4:30613478-30613500 GTTCAAAGTCACATTTTGGGAGG - Intergenic
980221342 4:129919984-129920006 ACTCAAAGGAATATTGTGGTTGG - Intergenic
981847925 4:149191085-149191107 GCTCACAGACGGATGGTGGGGGG + Intergenic
982834254 4:160103750-160103772 GTTCTAAGGCAGATTATGGAGGG + Intergenic
983154801 4:164333942-164333964 GCTTAAAGGAATATTGTGGCTGG - Intronic
987045663 5:14105439-14105461 GTTCAAAGGCAGATTGGGCCGGG + Intergenic
988896305 5:35678318-35678340 GGTTAGAAGCAGATTGTGGGTGG - Intronic
990471152 5:56116860-56116882 GCTCAAAGTCAGGTTGAGGTAGG + Intronic
990681617 5:58250966-58250988 GCTAAAATGCAGATTCTGGTGGG + Intergenic
990723398 5:58724842-58724864 ACACAAAGTCAGAATGTGGGAGG - Intronic
992562381 5:77965481-77965503 GCTCAAAAGTAGATTGTGCCAGG - Intergenic
994700878 5:103133456-103133478 CCAGAAAGGCAGATTGTGGTTGG + Exonic
995528536 5:113070052-113070074 GCTCAAAGGCAGATTGTGGGTGG + Intronic
1001256107 5:170184485-170184507 TCTCAAAGGCTGTGTGTGGGCGG - Intergenic
1001564681 5:172692034-172692056 GCTCAAAGGCAGGATGCTGGTGG - Intergenic
1002281257 5:178131199-178131221 GCCCAAGGGCAGATTGTTCGGGG - Intronic
1004813786 6:19289946-19289968 GCTTAAAGGCAGATTGCCGATGG - Intergenic
1004928861 6:20442272-20442294 ACTCAAAGGCAGATTGTTTCTGG - Intronic
1005703279 6:28426055-28426077 GCTTAAAGGCATGTTGTGGCTGG + Intergenic
1006397686 6:33797756-33797778 GGACAAAGGCAGATTTAGGGAGG - Intronic
1006707849 6:36037391-36037413 GCTCCAAGGCTGAATGTTGGGGG + Intronic
1006710675 6:36067060-36067082 GCTGAAATGGAGATGGTGGGTGG + Intronic
1006905438 6:37530190-37530212 GTTGGAAGGCAGATTTTGGGAGG - Intergenic
1007305105 6:40897639-40897661 CGGCAAAGGCAGAGTGTGGGTGG - Intergenic
1008558611 6:52700807-52700829 GCTTAAAGGCTAATTGTGTGAGG + Intergenic
1008973883 6:57401857-57401879 GCTCAACTGCAGCTTGTTGGAGG + Intronic
1009162773 6:60303362-60303384 GCTCAACTGCAGCTTGTTGGAGG + Intergenic
1015337052 6:132051392-132051414 GCTTAAAGGAAGGTTGTGGCTGG - Intergenic
1015626127 6:135182067-135182089 GCTGAAAAGCAGATTTTAGGGGG + Intronic
1018278535 6:162159062-162159084 GCTCTAAGGGTGAGTGTGGGAGG - Intronic
1018336920 6:162802124-162802146 TTTCAAGTGCAGATTGTGGGTGG + Intronic
1020567254 7:9813103-9813125 ACTCAAAGGAAGATGGTGGGTGG + Intergenic
1023582683 7:41699676-41699698 GCTGGAAGGCAGACTGTGAGGGG - Intronic
1025262388 7:57427419-57427441 CCTCAAAGGCAGATGTGGGGAGG - Intergenic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1028114401 7:86981493-86981515 GTTTAATGGCAGATGGTGGGAGG - Intronic
1028629355 7:92917347-92917369 GCACAAAGGCAGACTGTTGCTGG + Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030242538 7:107344441-107344463 GCTTAAAGGAAGGTTGTGGCTGG + Intronic
1033812427 7:145031351-145031373 GCATAAAGGCAGGATGTGGGTGG + Intergenic
1035289438 7:157828163-157828185 ACTCAGAGGAAGATGGTGGGAGG + Intronic
1036459556 8:8939787-8939809 GTTAAAATGCAGATTCTGGGTGG - Intergenic
1038502206 8:28054607-28054629 GCTCAGAGGGAGAGTGTGAGAGG - Intronic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1042785678 8:72544345-72544367 CCTGAAAGGCAGGTTGTTGGGGG + Intronic
1047388944 8:124434348-124434370 GCAGAAAGGCAGATAGAGGGGGG - Intergenic
1047774444 8:128057954-128057976 GATCAAAAGCTGATTGTGTGAGG + Intergenic
1048114395 8:131505408-131505430 GGACAAAAGCAGATTGTGGAGGG - Intergenic
1049450610 8:142659525-142659547 ACCCAGGGGCAGATTGTGGGAGG - Intronic
1049661856 8:143823106-143823128 GGTCAAAGGCTGGCTGTGGGTGG + Intronic
1049864552 8:144925549-144925571 GCTTAAAGACAGATTTGGGGTGG - Intergenic
1050114744 9:2252091-2252113 GCCCAAAGACAGACTGTGGGAGG - Intergenic
1050536154 9:6632727-6632749 GCTTGCAGGCAGAATGTGGGTGG + Intronic
1051501220 9:17779773-17779795 GCTCAAAGGATGGTGGTGGGGGG - Intronic
1051767754 9:20543090-20543112 GCTCAAGGGAAAATTGTGGCTGG + Intronic
1055336111 9:75235192-75235214 GGTCAAAGGCCCAGTGTGGGTGG - Intergenic
1056474569 9:86941405-86941427 ACTCAAAGCAAGGTTGTGGGAGG - Intergenic
1056955197 9:91075670-91075692 CCTGAAGGGCAGCTTGTGGGTGG - Intergenic
1058931393 9:109722834-109722856 AATCAAGGGCAGATTGTGAGGGG - Intronic
1059480769 9:114587744-114587766 GAGCAAGCGCAGATTGTGGGCGG + Exonic
1060989971 9:127843030-127843052 GCTCCAAGGCAGATGGGGTGAGG - Intronic
1187119560 X:16391410-16391432 GAGCAAAGGGAGATTGTGGTTGG - Intergenic
1187362612 X:18642287-18642309 ACTCAAGGTCAGATTTTGGGGGG - Intronic
1187391651 X:18890252-18890274 GCACAAAGGGCGATTGGGGGTGG + Intergenic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1189708628 X:43785401-43785423 GCTTAAAGGAATATTGTGGCTGG + Intronic
1194391652 X:93325563-93325585 GCTAAAAGCCAGATTCTGAGAGG + Intergenic
1196160740 X:112479733-112479755 TGTCAAAGCCATATTGTGGGTGG + Intergenic
1200101235 X:153689882-153689904 GGTCTAAGGCAGAGGGTGGGTGG - Intronic