ID: 995530209

View in Genome Browser
Species Human (GRCh38)
Location 5:113085006-113085028
Sequence CCTTCTATGCAGGAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530209_995530214 -4 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530214 5:113085025-113085047 AAGGCCTGCGTAAGGTCCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 79
995530209_995530213 -5 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530213 5:113085024-113085046 GAAGGCCTGCGTAAGGTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 88
995530209_995530215 -3 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530215 5:113085026-113085048 AGGCCTGCGTAAGGTCCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 72
995530209_995530221 24 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530221 5:113085053-113085075 CCCTTGTGCTGTCTCAGCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 137
995530209_995530223 25 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530223 5:113085054-113085076 CCTTGTGCTGTCTCAGCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530209 Original CRISPR CCTTCTATGCAGGAGCTGCA AGG (reversed) Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG + Intronic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG + Intergenic
907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG + Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913382275 1:118225460-118225482 CCTTCTGAGCATGAACTGCAAGG - Intergenic
917691287 1:177472070-177472092 GTTTATATGCAGGAGCTGCAGGG - Intergenic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
922722259 1:227905045-227905067 CCTTCTGTCCAGGGGCTGCTGGG - Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG + Intergenic
1073068850 10:100780886-100780908 CCTTCTAGGCAGCACCTCCATGG - Intronic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1079702381 11:23564949-23564971 CCTACTATGCAGTAGTTTCAAGG - Intergenic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG + Intergenic
1082835363 11:57647152-57647174 CCGTCTCTGCGGGGGCTGCACGG - Exonic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084331785 11:68434688-68434710 CCTTTTATGAAGGACCTGCTTGG + Intronic
1084812705 11:71624456-71624478 CATTGTATGAAGGAACTGCAGGG - Intergenic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1086167651 11:83798065-83798087 CCTTCTAAGCAGCATCTCCAAGG - Intronic
1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG + Intronic
1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG + Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1099933202 12:89097416-89097438 CCTTTTATCCAGGAGTTCCATGG + Intergenic
1099986043 12:89665709-89665731 CCTTCTGTTCAGGAGCTAGAAGG + Intronic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1102219637 12:111185855-111185877 CCTGCAATGTAGGAGCTGCTAGG + Intronic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105980944 13:25515497-25515519 CCTTCTGAGTATGAGCTGCAGGG - Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1109727113 13:66356274-66356296 ACTTCCATGAAGGTGCTGCAGGG - Intronic
1110171514 13:72506349-72506371 CCTTGTATGTAGCCGCTGCAGGG + Intergenic
1110336557 13:74338890-74338912 CCTTTTTTCCAGCAGCTGCAGGG - Intergenic
1112337306 13:98525854-98525876 CCTTCTATTCAGACCCTGCATGG - Intronic
1119052810 14:71386693-71386715 TCTTCTAGTCAGGAGCTGCCAGG - Intronic
1119183683 14:72621296-72621318 CCTTGCATACAGGAGCTGCTCGG + Intronic
1121743602 14:96270633-96270655 CCTACTTTTCAGGAGCTTCAGGG + Intergenic
1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG + Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1123205257 14:106706627-106706649 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1123210302 14:106753894-106753916 CCTCCTGTGCACCAGCTGCAGGG + Intergenic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1130833238 15:87624357-87624379 CTGTCTAAGCAGGAGCTACATGG + Intergenic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1131623411 15:94091661-94091683 CCTCCTATGCAGGGTCTCCATGG - Intergenic
1132585129 16:702838-702860 CTCTCTCTTCAGGAGCTGCAGGG + Intronic
1134414579 16:14032430-14032452 GCTTCAATGCAAGAGATGCATGG - Intergenic
1134900915 16:17937020-17937042 CCCCCTATGCAGAAACTGCACGG + Intergenic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1157211007 18:45742004-45742026 CACTCTGTGCAGGAACTGCATGG - Intronic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1166863762 19:45824054-45824076 CCATGTCTGGAGGAGCTGCAGGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
1167829592 19:52008487-52008509 CCTTCTATTCAGCTGCTGAAAGG - Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG + Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG + Intergenic
937313393 2:120915851-120915873 GCTTCTGAGCAGCAGCTGCAAGG - Intronic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
947063006 2:226187998-226188020 CCTTCTATGGAGTAGTTCCAAGG + Intergenic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
948782203 2:240328805-240328827 CCTTCCATTCAGGGGCTGCCGGG - Intergenic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1172928171 20:38560203-38560225 CCTTCTATGCAGTAGTTTTAGGG - Intronic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174136943 20:48386281-48386303 ACGTCCATGCAGGAGCTGCTGGG - Intergenic
1176660779 21:9633616-9633638 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
1185247528 22:49781090-49781112 CCATCAACACAGGAGCTGCACGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950462576 3:13134226-13134248 CCAGATATGCAGGGGCTGCAGGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
957813275 3:85256162-85256184 GCTGCTAACCAGGAGCTGCAGGG - Intronic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG + Intergenic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969244323 4:5922683-5922705 CCATGGATGCAGGAGCTGGAGGG - Intronic
969701659 4:8770997-8771019 CCTTCTATGCAACAACTGAAGGG + Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG + Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985922369 5:2987565-2987587 TCTTCTATTCAGGACCTGAATGG - Intergenic
986131046 5:4930515-4930537 CCTTCTTTGCTGGGGCTGCCAGG - Intergenic
989469277 5:41796257-41796279 CTCTCTATTCAGGAGCTTCAGGG + Intronic
990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG + Intronic
991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG + Intergenic
995061716 5:107817803-107817825 CATTCAATGCTAGAGCTGCAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG + Intronic
1002284904 5:178155651-178155673 CCTTCCATGTAAGAGCTGAAGGG - Intergenic
1004258156 6:14084118-14084140 CCTCCCAGGCAGGAGCTTCAAGG - Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG + Intronic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1007498574 6:42278981-42279003 CCTTCTATGCCAGGGCTGCTAGG + Intronic
1013174430 6:107665223-107665245 CCTTGCATTCAGGAGCTCCAAGG - Intergenic
1013819174 6:114134729-114134751 CCTTCTATGCTGGGACTGCCAGG + Intronic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1021411005 7:20330345-20330367 CTTTGTATGCAGCAGCTGCGGGG + Intergenic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG + Intergenic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1035441230 7:158902736-158902758 CCTCCTATGTGGTAGCTGCAAGG - Intronic
1035889751 8:3330522-3330544 ACTTCTAAGCAGGAGCTAAATGG + Intronic
1036391168 8:8325405-8325427 CCCTCTAAACAGGAGCCGCAGGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037803137 8:22045781-22045803 TATTCTATGAAGGAGGTGCACGG - Intronic
1038170082 8:25123411-25123433 CCTTCTATCCTGTAGCTGCAGGG + Intergenic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1046440844 8:114252127-114252149 TCTTGTATGCTGTAGCTGCAGGG + Intergenic
1049015010 8:139914028-139914050 CATTGTGTGCAGCAGCTGCAAGG + Intronic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG + Intergenic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1058453225 9:105116121-105116143 CCTTATATGCTGTATCTGCATGG - Intergenic
1059153159 9:111967130-111967152 TCTTCTCTGCAGGATCTGCTGGG - Intergenic
1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG + Exonic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1061981689 9:134108409-134108431 CCTCCTATGTGGGAGCTACAAGG + Intergenic
1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG + Intergenic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1203638347 Un_KI270750v1:135460-135482 CCCTCTATGCTGGATCTGCGAGG + Intergenic
1185458182 X:320688-320710 CCTCCAATCCAGGCGCTGCAGGG - Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1188381408 X:29497448-29497470 TCTTCCATGTAGGAGCTACATGG + Intronic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192944520 X:75950443-75950465 CCTTCTACATGGGAGCTGCAGGG + Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1197118913 X:122867118-122867140 GGTTCTATCCAGCAGCTGCAAGG - Intergenic
1201240615 Y:11954127-11954149 CCTTTTATTCAGGCGCTGCTAGG - Intergenic
1202331158 Y:23754517-23754539 AATTCTTTGAAGGAGCTGCAAGG - Intergenic
1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG + Intergenic