ID: 995530213

View in Genome Browser
Species Human (GRCh38)
Location 5:113085024-113085046
Sequence GAAGGCCTGCGTAAGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530209_995530213 -5 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530213 5:113085024-113085046 GAAGGCCTGCGTAAGGTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530213 Original CRISPR GAAGGCCTGCGTAAGGTCCC AGG Intronic
902198448 1:14815694-14815716 GAAGCCCTCTGTAAGTTCCCAGG - Intronic
903292881 1:22325889-22325911 GAAGGGCTGCCTTAGGGCCCAGG - Intergenic
920364446 1:205440652-205440674 GAAGGCATGCGGCAGGTCCTGGG + Intronic
920379905 1:205529278-205529300 GAGGGCCTGCGTGAGGCCCAGGG - Intronic
920926151 1:210343663-210343685 GAAAGCCTGCGGGTGGTCCCCGG + Intronic
922718435 1:227888493-227888515 GCAGGCCTGTGTGAGGGCCCAGG + Intergenic
1066504655 10:36028765-36028787 TAAGGCCAGCCTAAGGCCCCAGG - Intergenic
1074813331 10:117126353-117126375 GATGGGCTGCGTGAGGTGCCGGG + Intronic
1075536165 10:123274191-123274213 GAAGGCCTTCGGAAGGCCCAGGG - Intergenic
1079138292 11:17788952-17788974 GAAGGCCTCCTTAAGGACCATGG - Intronic
1081993819 11:47351284-47351306 CAATGACTGCGTAAGATCCCTGG + Exonic
1085272295 11:75277544-75277566 GAAGGTCTGCGCAAGGTCTGGGG - Intronic
1085319260 11:75564142-75564164 GCAGGCCTGACTCAGGTCCCAGG - Intronic
1086949427 11:92876457-92876479 GAAGGCCAGCCTGAGGTCTCTGG - Intronic
1088683396 11:112264712-112264734 GAGGGCCTGTGTGAGGACCCTGG + Intronic
1089601373 11:119617441-119617463 GAAGTCCAGCCTCAGGTCCCAGG + Intergenic
1094322857 12:29204534-29204556 GAAGGCCTGTGCAAAGGCCCTGG + Intronic
1094494770 12:30982475-30982497 AGAGGCCTGCGTAGGGTCCCAGG - Intronic
1104000706 12:124858015-124858037 GAAGGCCTGGTTCAGGTCCTGGG - Intronic
1108634904 13:52323592-52323614 AAGGGACTCCGTAAGGTCCCTGG + Intergenic
1110407308 13:75165244-75165266 GAAGGCCAGCGAACGGTTCCTGG + Intergenic
1131750759 15:95505633-95505655 TTAGGCATGCATAAGGTCCCAGG + Intergenic
1142021110 16:87783275-87783297 GAAGGCCAGAGTCAGGTCCATGG - Intergenic
1142608500 17:1095462-1095484 GAAGTCCTGCGTATGGGCTCAGG + Intronic
1143873730 17:9976248-9976270 ACAGGCCTTTGTAAGGTCCCAGG + Intronic
1146055056 17:29576812-29576834 GAAGGCCTGGGTCAGGGCACAGG + Intronic
1148350773 17:46940475-46940497 AAAGTCCTGCGCTAGGTCCCTGG - Intronic
1152938985 17:83155880-83155902 GCAGGCCTGCGCACGGTGCCAGG - Intergenic
1153409038 18:4772896-4772918 CAAGCCCTGCGTAAGGCCTCAGG + Intergenic
1153410019 18:4782771-4782793 GGAGCCCTGGGTGAGGTCCCTGG - Intergenic
1157812724 18:50709289-50709311 GAAGGCCTCAGGAAGGCCCCTGG - Intronic
1165419315 19:35715296-35715318 GAAAGTCTGCGCAAGCTCCCTGG + Exonic
1165790685 19:38489929-38489951 GAAGGCAGGCTTAAGGTTCCAGG + Intronic
1166018065 19:39998283-39998305 GAAGGCCTGGGATAGGTCACTGG - Exonic
1166351761 19:42202221-42202243 GAAGGCCTGGGTGAGGGCCATGG - Intronic
1166537119 19:43581237-43581259 CAAGGGCTGCATCAGGTCCCAGG + Exonic
1166753061 19:45173943-45173965 GAACCCCTGCCCAAGGTCCCAGG + Intronic
1167341408 19:48918663-48918685 GACGGGATGTGTAAGGTCCCTGG - Intronic
1167356447 19:49007099-49007121 GAAGGCCTGCGTCAGCGCCTCGG - Exonic
1168428258 19:56257038-56257060 GAATACCTGCGTAAGGGCTCTGG + Intronic
926647982 2:15310714-15310736 GAAGGCATGGGTGAGGGCCCAGG - Intronic
928012523 2:27623301-27623323 GAATGCCTGCAAGAGGTCCCTGG - Intergenic
928594000 2:32843325-32843347 GGAGGCCTGTGTAAGCTCCAGGG - Intergenic
936081299 2:109434392-109434414 GAAGGTCTGCGGAAGTTCTCAGG - Intronic
938407447 2:131040356-131040378 GAAGGCCTTCGTGAAGGCCCTGG + Exonic
947212745 2:227722855-227722877 GAAAGCCTGGGTATGGTCCAAGG - Intergenic
1171361291 20:24588181-24588203 GAAGGCCAGTGAAAGTTCCCAGG + Intronic
1172463119 20:35135021-35135043 GAAGTGCTGGCTAAGGTCCCAGG - Intronic
1173923023 20:46760139-46760161 AAAGGCTTGCGGAGGGTCCCTGG - Intergenic
1176376033 21:6087267-6087289 GGAGGCCTGGGTGGGGTCCCAGG - Intergenic
1176736088 21:10548196-10548218 GTTGGCCTGAGTAAGCTCCCAGG - Intronic
1179747442 21:43450977-43450999 GGAGGCCTGGGTGGGGTCCCAGG + Intergenic
1180043764 21:45293485-45293507 GCAGGCCTGCACAGGGTCCCTGG - Intergenic
1180215741 21:46323059-46323081 GACGGCCTGCGCGAGGTCACCGG + Exonic
1183385082 22:37509847-37509869 GAGGGCCTGCGGTAGGTACCAGG - Intronic
1183385125 22:37509966-37509988 GAGGGCCTGCGGTAGGTACCAGG - Intronic
1184067332 22:42128192-42128214 GAAGGCCTCAGTCAGGTCTCGGG + Exonic
1184070059 22:42141886-42141908 GAAGGCCTCAGTCAGGTCTCGGG + Intergenic
1184071802 22:42151490-42151512 GAAGGCCTCAGTCAGGTCTCGGG + Intergenic
1184278354 22:43423297-43423319 GAAGGCCTGGGAAAGGGCTCAGG - Intronic
1185213142 22:49583248-49583270 GAAGGCCGGGGTATTGTCCCAGG - Intronic
953452807 3:43018016-43018038 GAAGGGCTGCTTGAGGTCACGGG + Intronic
968869045 4:3232106-3232128 TAAGGACTGCGTACGGCCCCAGG - Intronic
974566230 4:63580793-63580815 GTAGGCCTGAGCAAGGTCCTGGG - Intergenic
985579373 5:688939-688961 GAGGGGCTGGGTCAGGTCCCCGG + Intronic
985594219 5:780998-781020 GAGGGGCTGGGTCAGGTCCCCGG + Intergenic
986307826 5:6528750-6528772 GATGGCCTGCAGCAGGTCCCTGG - Intergenic
992015829 5:72574357-72574379 GAAGGCCTGAGTAAGGGCCTGGG - Intergenic
993027615 5:82664491-82664513 GAAGGGCTGCATAAGTGCCCAGG + Intergenic
995530213 5:113085024-113085046 GAAGGCCTGCGTAAGGTCCCAGG + Intronic
998156369 5:139789040-139789062 GGAGGCCTGGGGAAGATCCCTGG - Intergenic
999419264 5:151426797-151426819 GAAAGCCTGGGTATGGTCCAAGG - Intergenic
1002801699 6:529208-529230 GAAGGGCGGCGTTAGGTCACAGG - Intronic
1004167771 6:13272119-13272141 GAATGCCTGCATTAGGTCCCAGG - Intronic
1005812448 6:29528017-29528039 GAAGGCCTGCCACAGGTCCCGGG - Intergenic
1008343024 6:50390613-50390635 GAAGGGCTGCTTAAGATCCATGG + Intergenic
1011027846 6:82888570-82888592 GAAAGGCTGCCAAAGGTCCCAGG + Intergenic
1017905833 6:158757095-158757117 GGAGGCCTGCGCCAGGCCCCGGG + Intronic
1019518201 7:1448756-1448778 GAAGGCCTGCGAAAGGTGGGAGG + Exonic
1019527481 7:1487252-1487274 CAAGGCCTCCGGAAGGTTCCGGG + Intronic
1033122699 7:138680017-138680039 CAAGGCCTGCGTCTGGCCCCAGG - Intronic
1034957585 7:155344537-155344559 GAAGGCCCCAGGAAGGTCCCGGG - Intergenic
1036647746 8:10622783-10622805 GAAGGCCAGCGTGAAGCCCCAGG - Exonic
1037728116 8:21500861-21500883 GAAGGCCTGAGGGAGTTCCCTGG + Intergenic
1049684135 8:143932531-143932553 CAAGGCCCGCCTCAGGTCCCTGG - Exonic
1050144526 9:2552444-2552466 GATGGCTTGCCTAAGGTCACCGG - Intergenic
1053904174 9:42824633-42824655 GTATGCCTGTGTACGGTCCCTGG - Intergenic
1054530810 9:66180880-66180902 GTATGCCTGTGTACGGTCCCTGG + Intergenic
1056538078 9:87548292-87548314 GAAGGCCTGCGTTAGACCCCTGG + Intronic
1060013870 9:120069253-120069275 GAGGGTCTGACTAAGGTCCCAGG + Intergenic
1189064899 X:37797019-37797041 GCAGGCCTGGGGAAGTTCCCTGG + Intronic
1192166014 X:68828272-68828294 GAAGGCGCGGGCAAGGTCCCGGG - Intergenic
1193964792 X:87972373-87972395 GAAGGCCTGGGTATTGTCCAAGG + Intergenic
1200108517 X:153727075-153727097 GAAGGCCTGTGTGTGCTCCCTGG + Intronic