ID: 995530214

View in Genome Browser
Species Human (GRCh38)
Location 5:113085025-113085047
Sequence AAGGCCTGCGTAAGGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530209_995530214 -4 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530214 5:113085025-113085047 AAGGCCTGCGTAAGGTCCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530214 Original CRISPR AAGGCCTGCGTAAGGTCCCA GGG Intronic
906647132 1:47483365-47483387 ACGGCCTCCATAAGGCCCCAAGG + Intergenic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
920154306 1:203935902-203935924 CAGACCTGAGTCAGGTCCCAAGG - Intergenic
923193865 1:231645441-231645463 AAGGTCTGCCTGATGTCCCAGGG + Intronic
1072034990 10:91555160-91555182 AAGGCTTGCCTGAGGTCACACGG - Intergenic
1076361414 10:129892042-129892064 ACGGCCTGCCTGAGGACCCAGGG + Intronic
1077709695 11:4523482-4523504 AAGGTCTGCTTTAGGACCCAGGG - Intergenic
1078089754 11:8257620-8257642 AAGGGCTGCCTAGGGTTCCATGG - Intronic
1083302901 11:61748097-61748119 AAGACCTGCCCAAGGTCGCATGG + Intergenic
1084193318 11:67508759-67508781 GAGGCCTGCGTTTGTTCCCATGG + Intergenic
1085319259 11:75564141-75564163 CAGGCCTGACTCAGGTCCCAGGG - Intronic
1085734274 11:79025626-79025648 GTAGCCTGTGTAAGGTCCCATGG + Intronic
1088615805 11:111626813-111626835 AAGGCATGTTTAAGGGCCCATGG - Intronic
1091311143 11:134576087-134576109 AGGACCTGCTTAAGGTCTCATGG - Intergenic
1105704842 13:22962402-22962424 GAGGCCTGGGGAAGGCCCCATGG - Intergenic
1105857802 13:24387560-24387582 GAGGCCTGGGGAAGGCCCCATGG - Intergenic
1105987591 13:25583585-25583607 AAGGGCTGCGTGTGCTCCCAGGG - Intronic
1106132377 13:26951072-26951094 GAGGCCTGCGGAAGGGCCCCAGG + Intergenic
1108634905 13:52323593-52323615 AGGGACTCCGTAAGGTCCCTGGG + Intergenic
1131750760 15:95505634-95505656 TAGGCATGCATAAGGTCCCAGGG + Intergenic
1138264424 16:55650381-55650403 AAAGCCTGAGTCAGGACCCATGG + Intergenic
1141929960 16:87195830-87195852 GTGGCCTGCTTAAGGTCCTATGG + Intronic
1142608501 17:1095463-1095485 AAGTCCTGCGTATGGGCTCAGGG + Intronic
1146055057 17:29576813-29576835 AAGGCCTGGGTCAGGGCACAGGG + Intronic
1152938984 17:83155879-83155901 CAGGCCTGCGCACGGTGCCAGGG - Intergenic
1155515269 18:26618131-26618153 AAGACTTGCTTAAGGTCACATGG - Intronic
1157705581 18:49802801-49802823 AAGGCCTCCGTAAGCTCCAAAGG + Exonic
1157756908 18:50226674-50226696 AAAGCCAGCGCAAGGTCCCTTGG - Intergenic
1160462366 18:79048711-79048733 AAGGCCAGCGTGATGTCCCAAGG - Intergenic
1160874318 19:1290171-1290193 AAGGCCTGAGGGTGGTCCCAGGG + Intronic
926620152 2:15040093-15040115 AAGGCCTTCAGAAGGTCCCCTGG + Intergenic
927480135 2:23447200-23447222 AAGGTCTGCATTTGGTCCCAGGG - Intronic
927684336 2:25160444-25160466 GAGACTTGCCTAAGGTCCCATGG + Intergenic
931988147 2:67760996-67761018 AATGCCTGCCTAAGATCACATGG + Intergenic
938099618 2:128489804-128489826 AAGGGCCGGGTAAGGTCCCCTGG - Intergenic
938731457 2:134151140-134151162 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731467 2:134151180-134151202 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731478 2:134151220-134151242 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731569 2:134151568-134151590 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731579 2:134151608-134151630 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731590 2:134151648-134151670 AGGGCATGAGTGAGGTCCCATGG - Intronic
938731636 2:134151820-134151842 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731647 2:134151860-134151882 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731660 2:134151900-134151922 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731693 2:134152028-134152050 AGGGCATGAGTGAGGTCCCACGG - Intronic
938731785 2:134152341-134152363 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731798 2:134152381-134152403 AGGGCGTGAGTGAGGTCCCATGG - Intronic
938731811 2:134152421-134152443 AGGGCGTGAGTGAGGTCCCATGG - Intronic
942276060 2:174325031-174325053 AAGGCCCGCCCAAGGTCACAGGG + Intergenic
946069085 2:217015613-217015635 CAGGCCTGCGTTTGATCCCAGGG + Intergenic
948145213 2:235703502-235703524 AAGGCTTCTGTAAGGTTCCAAGG - Intronic
948995586 2:241576589-241576611 AAGGCCTGTGCAAGGCCTCATGG - Intergenic
1169862596 20:10168312-10168334 AAGGATTGCAAAAGGTCCCATGG - Intergenic
1174111729 20:48202006-48202028 AAGGCCTGGGGATGGTCCCCAGG + Intergenic
1176736087 21:10548195-10548217 TTGGCCTGAGTAAGCTCCCAGGG - Intronic
1183344508 22:37299797-37299819 ATGGCTTGCTTAAGGTCACACGG - Intronic
1183385081 22:37509846-37509868 AGGGCCTGCGGTAGGTACCAGGG - Intronic
1183385124 22:37509965-37509987 AGGGCCTGCGGTAGGTACCAGGG - Intronic
1184278353 22:43423296-43423318 AAGGCCTGGGAAAGGGCTCAGGG - Intronic
1185213141 22:49583247-49583269 AAGGCCGGGGTATTGTCCCAGGG - Intronic
956878355 3:73486269-73486291 ATGGCCTGTGTAAGAGCCCATGG + Intronic
964570364 3:158103536-158103558 AAACCCTGCATAAGGTCCCCTGG + Intronic
965542341 3:169882582-169882604 AAGGCCTCTCTGAGGTCCCAAGG - Intergenic
985754556 5:1705451-1705473 AAGCCCAGCGTAACTTCCCAAGG - Intergenic
991191215 5:63876163-63876185 AAGCCATGCTTAAGTTCCCAAGG - Intergenic
993027616 5:82664492-82664514 AAGGGCTGCATAAGTGCCCAGGG + Intergenic
995410558 5:111852626-111852648 AGGGCTTTCCTAAGGTCCCAAGG - Intronic
995530214 5:113085025-113085047 AAGGCCTGCGTAAGGTCCCAGGG + Intronic
997677571 5:135724641-135724663 AAGCCTTGCCTAAGGTCACAGGG + Intergenic
1002712399 5:181203498-181203520 CAGGCCTCTGTAATGTCCCACGG + Intronic
1005812447 6:29528016-29528038 AAGGCCTGCCACAGGTCCCGGGG - Intergenic
1019518202 7:1448757-1448779 AAGGCCTGCGAAAGGTGGGAGGG + Exonic
1026037131 7:66837769-66837791 AAGGCCTGAGTGAGGACCCACGG - Intergenic
1030123993 7:106137495-106137517 CAGGCCTGCCTAAGTTCCCCCGG + Intergenic
1036748565 8:11428365-11428387 AAGGCCTGTGTCAGTTTCCATGG + Intronic
1042103392 8:65298011-65298033 AAGGCCTGCTTTAGTTCTCATGG + Intergenic
1049309950 8:141928495-141928517 AAATCCAGGGTAAGGTCCCAGGG + Intergenic
1052417186 9:28191132-28191154 AAAGCATGAGAAAGGTCCCATGG + Intronic
1056893966 9:90523459-90523481 AAGCCCTGGCTAAGGTCACAAGG + Intergenic
1057779154 9:98035664-98035686 AGGGCCTGCCTCAGGTCCCATGG - Intergenic
1060013871 9:120069254-120069276 AGGGTCTGACTAAGGTCCCAGGG + Intergenic
1060085663 9:120698263-120698285 AGGGCCTACATAAGATCCCAAGG + Intronic
1188190022 X:27161474-27161496 AAGGCCAGCCTCAGGTTCCATGG - Intergenic
1196444391 X:115737893-115737915 AATGCCAGCGGAAAGTCCCATGG + Intergenic
1199345599 X:146734908-146734930 AAGGCCAGGGCAAGGTTCCAAGG + Intergenic