ID: 995530215

View in Genome Browser
Species Human (GRCh38)
Location 5:113085026-113085048
Sequence AGGCCTGCGTAAGGTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530209_995530215 -3 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530215 5:113085026-113085048 AGGCCTGCGTAAGGTCCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530215 Original CRISPR AGGCCTGCGTAAGGTCCCAG GGG Intronic
900946825 1:5835486-5835508 AGGCCTGGGTCAGGTCCCAGAGG - Intergenic
913526565 1:119699314-119699336 AGTCCTGCCTAAGATCCTAGTGG + Intronic
916819931 1:168388303-168388325 AGGCCTGTGCAGGCTCCCAGAGG + Intergenic
1070566792 10:77609784-77609806 AGGCCTGCGTCAGGAACAAGAGG + Intronic
1072615842 10:97048521-97048543 AGGCTTGCTGAAGGTCCCAGAGG - Intronic
1072852477 10:98910625-98910647 AGGCCTGAGAACGGGCCCAGAGG + Intronic
1076204512 10:128586004-128586026 AGGCCACCCTCAGGTCCCAGAGG - Intergenic
1076834825 10:133015806-133015828 AGCCCTGCGGAGGGTCCGAGAGG - Intergenic
1077284295 11:1758939-1758961 AGTCCTGGGAAAGGCCCCAGAGG + Intronic
1079014483 11:16856959-16856981 AGGCCTGGGCAAGGACCCTGAGG + Intronic
1081648886 11:44809913-44809935 AGGGCTGTGTGAGGACCCAGTGG - Intronic
1083870760 11:65487067-65487089 TGACCTGCTGAAGGTCCCAGGGG + Intergenic
1085319258 11:75564140-75564162 AGGCCTGACTCAGGTCCCAGGGG - Intronic
1085734275 11:79025627-79025649 TAGCCTGTGTAAGGTCCCATGGG + Intronic
1087115553 11:94520755-94520777 AGGCCTGCAAAAGGTGGCAGGGG - Intergenic
1091389490 12:117468-117490 AGGCCTGAGGAAGCTTCCAGAGG + Intronic
1101812804 12:108122288-108122310 TGGCCTGCCTAAGGTCACATAGG + Intergenic
1102639380 12:114353258-114353280 TTGCCTGGGAAAGGTCCCAGGGG + Intergenic
1105723889 13:23142189-23142211 AGGCCAGCGAAAGTTCCGAGTGG + Intergenic
1105987590 13:25583584-25583606 AGGGCTGCGTGTGCTCCCAGGGG - Intronic
1110209949 13:72959369-72959391 AGGCCTGCTTGAGGTCCGATAGG - Intronic
1113763090 13:112863694-112863716 AGGCCTGCGCAGCTTCCCAGCGG + Intronic
1113763293 13:112864883-112864905 AGGCCTGCGCAGCTTCCCAGCGG + Intronic
1119226723 14:72950114-72950136 AGGGCTGTGGGAGGTCCCAGGGG + Intronic
1125252313 15:37719110-37719132 AGGCCAGAGTGAGGTCTCAGAGG + Intergenic
1127335383 15:57979124-57979146 AGACCTGCCTCAGGGCCCAGTGG - Intronic
1128755290 15:70179539-70179561 GGACCTGCCTAAGGTCACAGAGG + Intergenic
1129231156 15:74197844-74197866 AGGCCTGCGTCAGGCCCCCCTGG + Intronic
1129255757 15:74333131-74333153 AGGCCTGTGTAGGGTCCAGGTGG - Intronic
1129323745 15:74788898-74788920 AGGCCTGGGTTAGGGCCCTGGGG + Intronic
1132572797 16:651337-651359 AGGGCTGGGAAAGGACCCAGTGG + Intronic
1137767774 16:50991253-50991275 AGCCCACCGCAAGGTCCCAGAGG - Intergenic
1139433424 16:66923334-66923356 AGGGCTCCGGAAGGCCCCAGAGG - Intronic
1141806361 16:86344349-86344371 AAGCCTGCGTCTGGTTCCAGAGG + Intergenic
1142608502 17:1095464-1095486 AGTCCTGCGTATGGGCTCAGGGG + Intronic
1143487625 17:7263202-7263224 CGGCCGGCTTTAGGTCCCAGTGG - Intronic
1144829611 17:18123923-18123945 AGGCCTGCGTATGTGCCCACAGG + Intronic
1145123555 17:20281843-20281865 AGGCCTGAGCATGGTCCTAGGGG + Intronic
1146055058 17:29576814-29576836 AGGCCTGGGTCAGGGCACAGGGG + Intronic
1146283148 17:31558409-31558431 AGGCCTGGTTCAGGTCCCAGAGG + Intergenic
1150792218 17:68207900-68207922 GGGCCAGCGTGAGTTCCCAGTGG + Intergenic
1152218519 17:79048309-79048331 AGGGCCGCGGAAGGTCCCAGAGG - Exonic
1152842911 17:82581248-82581270 TGGCCTGAGTCAGGTCCCAGCGG + Intronic
1152914243 17:83024707-83024729 AGGCCTGGGTAAGGGGCCTGAGG + Intronic
1154063820 18:11088064-11088086 AGGTCTGCCTAAGGTCCAGGGGG - Intronic
1156039697 18:32806711-32806733 AGACCTGCTTATGTTCCCAGGGG + Intergenic
1157705582 18:49802802-49802824 AGGCCTCCGTAAGCTCCAAAGGG + Exonic
1160462365 18:79048710-79048732 AGGCCAGCGTGATGTCCCAAGGG - Intergenic
1160874319 19:1290172-1290194 AGGCCTGAGGGTGGTCCCAGGGG + Intronic
1164715392 19:30387185-30387207 AGGCCTCAGTATGGTACCAGAGG + Intronic
1165795802 19:38518490-38518512 AGGCCAGGGTAAGGGGCCAGAGG + Intronic
1168351807 19:55680327-55680349 AGGCCTGGGGAGAGTCCCAGAGG - Intronic
928184781 2:29100739-29100761 AGGCCTGTGCAAGGTTACAGAGG + Intronic
932844228 2:75118908-75118930 AAGCCTGAGCAAGGTCCCAGCGG - Intronic
938903415 2:135817538-135817560 GGGCCTGAGGCAGGTCCCAGTGG + Exonic
945069617 2:205977272-205977294 AGGCCAGCGTGAGTTCCCAGTGG + Intergenic
948179322 2:235967108-235967130 AGGCCTGCGGAAGGTGGCACTGG - Intronic
1171982207 20:31636131-31636153 AGGCCTGTGCAAAGACCCAGAGG - Intergenic
1183439390 22:37814873-37814895 TCTCCTGTGTAAGGTCCCAGAGG - Intronic
1185232798 22:49693087-49693109 AGGCCTGGGGGAGGTCACAGAGG + Intergenic
954633314 3:52058322-52058344 AGGCCTGAGCAAACTCCCAGGGG + Intergenic
955230822 3:57097581-57097603 AGGCCTGGGTAAGGTGCCTTTGG - Exonic
965680635 3:171247830-171247852 ATTGCTGTGTAAGGTCCCAGGGG - Intronic
967076592 3:186008854-186008876 AGTCCTGGGTGAGGCCCCAGGGG - Intergenic
968498428 4:931926-931948 AGGGCTGGGGAGGGTCCCAGCGG - Intronic
970135907 4:12923654-12923676 AGGCCAAAGTAAGATCCCAGGGG - Intergenic
976367627 4:84247600-84247622 AGGCCAGGGTGGGGTCCCAGAGG - Intergenic
981806459 4:148721155-148721177 AGTACTGAGTAAGGTCCCAGAGG - Intergenic
982027168 4:151262497-151262519 AGGCCTGTGAAAGGTGCCTGAGG - Intronic
995530215 5:113085026-113085048 AGGCCTGCGTAAGGTCCCAGGGG + Intronic
1002712400 5:181203499-181203521 AGGCCTCTGTAATGTCCCACGGG + Intronic
1004820443 6:19362462-19362484 AGGTCAGCGTAAGGTACCAATGG + Intergenic
1019518203 7:1448758-1448780 AGGCCTGCGAAAGGTGGGAGGGG + Exonic
1021346895 7:19539899-19539921 GGGCCTGCTTAAGGACCCCGAGG + Intergenic
1024343341 7:48288878-48288900 AGGCCTACCTAGGGGCCCAGGGG - Intronic
1039471278 8:37815100-37815122 AGCCCTGGGCAGGGTCCCAGTGG - Intronic
1051174313 9:14347655-14347677 AGGTCCGCCCAAGGTCCCAGAGG + Intronic
1057167521 9:92940615-92940637 AGGCCTGGCCAAGGGCCCAGTGG - Intergenic
1060492124 9:124092748-124092770 GGCCCTGGGTAAGGTCCCAAAGG - Intergenic
1062119461 9:134826452-134826474 AGGCCTCCGAAAGGCCACAGAGG - Intronic
1062354434 9:136154928-136154950 TGGCCAGCTTGAGGTCCCAGTGG - Intergenic
1186423161 X:9443016-9443038 AGGGCTGTGAAAGGTCCCGGAGG + Intergenic