ID: 995530221

View in Genome Browser
Species Human (GRCh38)
Location 5:113085053-113085075
Sequence CCCTTGTGCTGTCTCAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530209_995530221 24 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530221 5:113085053-113085075 CCCTTGTGCTGTCTCAGCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 137
995530211_995530221 14 Left 995530211 5:113085016-113085038 CCTGCATAGAAGGCCTGCGTAAG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 995530221 5:113085053-113085075 CCCTTGTGCTGTCTCAGCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 137
995530216_995530221 1 Left 995530216 5:113085029-113085051 CCTGCGTAAGGTCCCAGGGGAAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 995530221 5:113085053-113085075 CCCTTGTGCTGTCTCAGCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530221 Original CRISPR CCCTTGTGCTGTCTCAGCTA AGG Intronic
900299055 1:1967647-1967669 GCCTTGGGCTGCCTCAGCTTTGG - Intronic
900515435 1:3079679-3079701 CCCTGGAGCAGTCTCAGCTCTGG - Intronic
902374356 1:16023314-16023336 CCCTGGTGCTCTCTAAGCTATGG + Intronic
902379310 1:16045192-16045214 TCCTGGTGCTCTCTAAGCTATGG + Intronic
902705454 1:18201164-18201186 CCCCTGAGCTGTCTCAGCATGGG + Intronic
910474228 1:87589763-87589785 CCCTTGTGCTGTCATAGTTAGGG - Intergenic
912697275 1:111850734-111850756 CCCTTGAGCATTCTCAGCCAGGG + Intronic
916505334 1:165423387-165423409 CCCTTTTGCAGACTCAGCCAGGG + Intronic
916855074 1:168740982-168741004 TCCTTGTTCTCTCTCAGGTAAGG + Intergenic
918132998 1:181645534-181645556 GGCTTCTGCTGTCTCAGCGAAGG + Intronic
919370412 1:196717712-196717734 CCCTTTTGCTGTATCTGCTCTGG - Intronic
919728189 1:200897124-200897146 CCATTGTGTCGGCTCAGCTAGGG - Intronic
921216988 1:212946333-212946355 GAATTGTGCTGTCTCAGCAAGGG - Intergenic
923107556 1:230866312-230866334 CCCCTCTGCTGTCTGAGCTGAGG + Intronic
1065676848 10:28185435-28185457 CTTTTGTGTTGTCTCAGTTATGG - Intronic
1066286052 10:33967039-33967061 CCCTTGTGGGGTCACAGCCATGG - Intergenic
1067031514 10:42880921-42880943 CCCTTGGGCTGGCTCAGCCCAGG - Intergenic
1067352008 10:45484895-45484917 ACCTTGAGCTGTCACATCTAAGG - Intronic
1067570001 10:47364807-47364829 CCCGTGTGCTGTCTCAGGTGAGG - Intergenic
1068218390 10:54011434-54011456 CCCTTGTTGTGTCTAAGCTGGGG + Intronic
1071495230 10:86163325-86163347 CCCTAGCTCTGTCTCTGCTATGG - Intronic
1073156569 10:101351965-101351987 CTCTTCTGCAGTCTCATCTAGGG + Intergenic
1074776601 10:116771931-116771953 CAGCTGTGCTGTCTCAGCCACGG + Intergenic
1075841534 10:125508759-125508781 CCCTTTTGCTCTCTCATCTCTGG - Intergenic
1078944066 11:16043994-16044016 CTCTGGTGCAGTCTCAACTAGGG - Intronic
1084792207 11:71482068-71482090 CCCTTGGGCTGCCTGAGTTAGGG + Intronic
1085694997 11:78696705-78696727 CCTTTGTGCTGACTCAGAGAGGG + Intronic
1089692510 11:120195630-120195652 CCCTTGGGAGGTCTCAGCTGTGG + Intergenic
1093027870 12:14260928-14260950 CCCTTGCTCTCTCTGAGCTAGGG + Intergenic
1095088887 12:38086239-38086261 CCCCTGGGCTGTGTCAGCAAAGG + Intergenic
1096385441 12:51192079-51192101 GCCATGGGCTGTCTCCGCTATGG - Intronic
1099884611 12:88511724-88511746 CCATTGTTCTGTGTCTGCTAGGG - Intronic
1106299839 13:28453509-28453531 CATGTGTGCTGTCTCAGCAATGG + Intronic
1108456231 13:50616772-50616794 CTCTGATACTGTCTCAGCTATGG + Intronic
1111068357 13:83128446-83128468 CCCTTGCTCTATCTCAGCTTTGG - Intergenic
1112766154 13:102746249-102746271 CCCAGGTGCTGGCTCAGCTGTGG + Exonic
1113207032 13:107929047-107929069 ACCTTGTTCAGTCTCAGCTGGGG + Intergenic
1115069993 14:29309909-29309931 GTCTTGTGCTGCCTCAACTAAGG - Intergenic
1115896394 14:38093006-38093028 CACTTGGGGTGTCTCACCTATGG + Intergenic
1118005549 14:61561844-61561866 CCCCTGTGCTTCCTCAGCCAAGG - Intronic
1120023869 14:79560402-79560424 CCCCAGTGCTGTCTTACCTAGGG - Intronic
1122796415 14:104208379-104208401 CTCTGGTGCTGTCGCAGCTCTGG - Intergenic
1123097987 14:105775374-105775396 CCCCTGTGCTGGCTCCGCTTAGG + Intergenic
1129772799 15:78213474-78213496 CCCCTCTGCTCCCTCAGCTAAGG + Intronic
1139349860 16:66328151-66328173 CCCTTCTGGTGTCCCAGCTAGGG + Intergenic
1140792359 16:78404333-78404355 ACCTTGTGCTCTCACACCTAGGG - Intronic
1142259076 16:89034003-89034025 CCCGTGTGCTGTGTGAGCCAGGG - Intergenic
1148016039 17:44523339-44523361 CCCTGGTGCTGTCTGACCTGGGG + Intergenic
1151786961 17:76279733-76279755 CCCAGGAGCTGTCTCAGCTCTGG + Intronic
1155356559 18:24959220-24959242 CCCTCGAGCTGTCTCAGACATGG + Intergenic
1156397970 18:36716432-36716454 ATCCTTTGCTGTCTCAGCTACGG - Intronic
1157807290 18:50667655-50667677 GCCCTGGGCTGTCTCAGCCAGGG - Intronic
1158165129 18:54531632-54531654 TCCTCGGGCTTTCTCAGCTAAGG + Intergenic
1158237767 18:55338348-55338370 CCCCTGTGCTTTCAAAGCTAAGG - Intronic
1159009151 18:63041740-63041762 CTCTTCTGCTGTCTCAGACAGGG + Intergenic
1160365343 18:78319802-78319824 CCCTTGAGCTGTCTGATTTATGG + Intergenic
1161007705 19:1944711-1944733 CCTTTGTGCTACCTCAGCGAGGG + Intronic
1162387393 19:10368100-10368122 CCCCTGTGCTGTCTGATCTGAGG + Exonic
1163294927 19:16405869-16405891 CCGTTGTGCTATTTCAGCTTTGG - Intronic
1166592032 19:44008103-44008125 CTCTTGGGGTGCCTCAGCTATGG - Intronic
1168687802 19:58358832-58358854 CCCCAGTGCTGGCTCAGCTGGGG + Intronic
925150153 2:1610151-1610173 CAGTTGTGATGGCTCAGCTATGG - Intergenic
926361905 2:12096568-12096590 TGCTGCTGCTGTCTCAGCTATGG - Intergenic
928427110 2:31188448-31188470 CCCTTGTGGTGCCTCAGTGAAGG - Intronic
929077767 2:38092643-38092665 CCATTGTGCTGAGTCAGCCACGG + Intronic
929675936 2:43929674-43929696 CCCTTGTTCTGTGCTAGCTATGG - Intronic
929886474 2:45883393-45883415 CCCTGCTGCTGGCTCAGCTGTGG + Intronic
929962230 2:46505396-46505418 CCCTTTTGCTGCATCAGCAATGG + Intronic
930377983 2:50591723-50591745 ACCATGTGCTGTCCCAGATAGGG - Intronic
930909216 2:56610674-56610696 CCATTCTCCTGTCTCAGCTAAGG - Intergenic
931104044 2:59034793-59034815 CCCTTGTTCTGTCTCCACGAGGG + Intergenic
931734258 2:65179772-65179794 CCCTTGTTCAGTCTCAGCTTTGG + Intergenic
935468012 2:103422526-103422548 CCCTTGTGCCATCTGAGCCAGGG + Intergenic
936577049 2:113665947-113665969 CCTTTGAGCTTTCTCAGCCAGGG + Intergenic
939161335 2:138593515-138593537 CCCTTCTGCTGTCTTTGTTAGGG + Intergenic
945051384 2:205827478-205827500 CCCTTCTGATGTGTCAGCTGGGG - Intergenic
948307978 2:236963860-236963882 CCCATCTGCATTCTCAGCTAAGG + Intergenic
1168844198 20:932266-932288 CCTTTGGGCTGTGTCTGCTAGGG - Intergenic
1170400097 20:15972760-15972782 CAATGGTGCTGTCTCAGCTCAGG - Intronic
1170540220 20:17380055-17380077 CACTGGAGCTGTCTCATCTAGGG - Intronic
1171046246 20:21811113-21811135 CTCTTGTGGTGTCTCATCAAAGG - Intergenic
1171485840 20:25484972-25484994 CCCATGTGCTGTGCCAGCTGAGG + Intronic
1172906908 20:38377217-38377239 CCCTTGTCCTGTCTCAGGCAGGG + Intergenic
1173443535 20:43097815-43097837 CCCCTGTGCTGTTTCCTCTAAGG - Intronic
1174158924 20:48536577-48536599 ACCTTGTGCTGTCTCACCCTGGG - Intergenic
1175691108 20:61066555-61066577 CCCCTCTGCTGTCCCAGCCACGG - Intergenic
1177078414 21:16607719-16607741 CCCTTGTGTTTTCTCTGCCAGGG + Intergenic
1179331599 21:40407686-40407708 CATTTGGGCTGTCTCAGCTGAGG + Intronic
1180000393 21:44992951-44992973 CCCTTGTGCTGTGCCCGCCATGG - Intergenic
1180229661 21:46419501-46419523 GCCCTGTGCTGTCACAGCCAAGG + Intronic
1181612620 22:24028580-24028602 CCCTTGTTCTGTCTTTGTTATGG + Intronic
1182431694 22:30302597-30302619 CCCTCGTGCCATCTCAGCTGTGG - Intronic
1185423192 22:50746729-50746751 CCTTTGAGCTTTCTCAGCCAGGG - Intergenic
954239659 3:49283649-49283671 CTGTTGTGCTGCCTCTGCTAAGG + Intronic
960119725 3:113935290-113935312 CACCTGTGCTGTCTAAGCTCTGG + Intronic
967977473 3:195043631-195043653 CCCTGCTGCTGGCTCAGCCAAGG + Intergenic
970573186 4:17402715-17402737 CCATTCTCCTGTCTCAGCTCTGG - Intergenic
971083998 4:23248979-23249001 CTCTTGTGCTTTATCAGATAAGG + Intergenic
973944312 4:55941795-55941817 CCCTTGTGCTATAGGAGCTAAGG + Intergenic
981364735 4:143889268-143889290 CACCTCTGCTGTCTCAGCAATGG - Intronic
981375235 4:144007539-144007561 CACCTCTGCTGTCTCAGCAATGG - Intronic
981385851 4:144129740-144129762 CACCTCTGCTGTCTCAGCAATGG - Intronic
982187405 4:152816543-152816565 CACTTGTGCTGTTTTAGATATGG - Intronic
982625605 4:157762175-157762197 TCCTTCTGCTGTCTCAGATGAGG + Intergenic
983755481 4:171329339-171329361 ACATTGTGCTGTGTCAGCCACGG + Intergenic
985838253 5:2286611-2286633 CCCTTGTGGTGCCACAGCTATGG - Intergenic
985888793 5:2700046-2700068 ACCCTGTGCTGGCACAGCTAAGG + Intergenic
988706475 5:33730887-33730909 CCCTTCTGCTATCTCTGCCAAGG - Intronic
995530221 5:113085053-113085075 CCCTTGTGCTGTCTCAGCTAAGG + Intronic
999463189 5:151774251-151774273 CCCTGGTGCAGTGTCAGCTCAGG - Intronic
999774834 5:154803816-154803838 CCCTTGCCTTGTCTGAGCTAAGG + Intronic
1000847219 5:166296901-166296923 CCCTTTCTCTGTCACAGCTATGG + Intergenic
1004397582 6:15259466-15259488 GCCTGGTGCTGTCACAGCTCTGG - Intronic
1004503800 6:16231263-16231285 CCTGTGTCCTGTGTCAGCTAGGG + Intergenic
1006143579 6:31945307-31945329 CCCAGGTGCTGCCTCAGCCAGGG - Exonic
1006425281 6:33959539-33959561 CCCAGGGGCTGTCTGAGCTATGG + Intergenic
1007391487 6:41552003-41552025 CACATGTCCTGTCTCAGCTGGGG - Intronic
1012759456 6:103279949-103279971 CCTTTGGGCTGTGTCTGCTAGGG + Intergenic
1020275699 7:6623193-6623215 CCCGTGTGCTGTTTCAGCCCCGG - Exonic
1023254811 7:38302377-38302399 CCCTGGTGCTGCCACAGCCAGGG + Intergenic
1025837280 7:65106054-65106076 CCCATGAACTGTCTCAGCCAGGG - Intergenic
1025907060 7:65795580-65795602 CCCATGAACTGTCTCAGCCAGGG - Intergenic
1030012711 7:105186993-105187015 CCCTTGAGATGTCTCAGTTGAGG + Intronic
1030985379 7:116236045-116236067 CCCTTGTGCTGTCTCTTCAAGGG + Intronic
1035607966 8:941390-941412 CCCTTTTGCTTTGTCAGCCAAGG + Intergenic
1039326896 8:36495556-36495578 CCCAGGTGCTGGCTCAGGTATGG - Intergenic
1039615167 8:38949942-38949964 CCCTTGTTCTGTCTCTACAAAGG + Intronic
1039818125 8:41112688-41112710 ACCTTGTACTGCCTCAGCTGGGG + Intergenic
1040042546 8:42931265-42931287 AGCATGTGCTGTCTCAGCCAGGG + Intronic
1041931280 8:63289622-63289644 CCTTTGTGTTAGCTCAGCTATGG + Intergenic
1048091340 8:131243706-131243728 CTCTTGTGCTGTCCCTGCTGGGG - Intergenic
1048147512 8:131860106-131860128 CCCCTGTGCTGTCTTTGCTTTGG - Intergenic
1049389039 8:142358786-142358808 CCCTTGTGGTCTCCCAGCGATGG - Intronic
1050834502 9:10058894-10058916 CCTATGTGCTGTCTCAGTTAAGG - Intronic
1052435543 9:28423461-28423483 CCTTTGTGGTTTCTCAGCCATGG + Intronic
1052696158 9:31881705-31881727 CCCTAGTCCAGTTTCAGCTAAGG + Intergenic
1055548466 9:77408005-77408027 CCTTTGGTCTGTGTCAGCTATGG - Intronic
1056900987 9:90599224-90599246 CCCTTGTGGTCTCTCAACCATGG + Intergenic
1057909329 9:99005514-99005536 TCCCTGTGCTGTCTCTACTATGG + Intronic
1057911237 9:99021946-99021968 CCCTTAAGCTGTCTCTGCAAAGG + Intronic
1057919910 9:99088417-99088439 CCCATGGGATGGCTCAGCTACGG - Intergenic
1190360248 X:49642501-49642523 CACTTTTGCTGTCTCTGCGATGG + Intergenic
1190730153 X:53220521-53220543 CCTTTTTGTTGACTCAGCTAGGG + Intronic
1193521494 X:82535342-82535364 CTCTTCTGATGTCTCAGATAAGG + Intergenic
1200736427 Y:6802574-6802596 GCTTTGTGATGTCTCAGCTGTGG + Intergenic
1200873908 Y:8132764-8132786 CCCTGGTGGTGTCACAGGTAAGG - Intergenic
1201522602 Y:14892633-14892655 CCCTTCTCCTGCCTCAGCTCCGG - Intergenic
1202042099 Y:20696571-20696593 CCTATGTGCTGTTTCAGCAAAGG + Intergenic