ID: 995530223

View in Genome Browser
Species Human (GRCh38)
Location 5:113085054-113085076
Sequence CCTTGTGCTGTCTCAGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530217_995530223 -10 Left 995530217 5:113085041-113085063 CCCAGGGGAAGCCCCTTGTGCTG 0: 1
1: 0
2: 0
3: 24
4: 180
Right 995530223 5:113085054-113085076 CCTTGTGCTGTCTCAGCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 168
995530216_995530223 2 Left 995530216 5:113085029-113085051 CCTGCGTAAGGTCCCAGGGGAAG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 995530223 5:113085054-113085076 CCTTGTGCTGTCTCAGCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 168
995530209_995530223 25 Left 995530209 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 170
Right 995530223 5:113085054-113085076 CCTTGTGCTGTCTCAGCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 168
995530211_995530223 15 Left 995530211 5:113085016-113085038 CCTGCATAGAAGGCCTGCGTAAG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 995530223 5:113085054-113085076 CCTTGTGCTGTCTCAGCTAAGGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530223 Original CRISPR CCTTGTGCTGTCTCAGCTAA GGG Intronic
904501029 1:30913016-30913038 ACAAGTGCTGTCTCAGCTCAAGG + Intergenic
906010249 1:42516675-42516697 CCTTATGCTATTTCAGCTTATGG - Intronic
908314649 1:62920808-62920830 CCTTGTCCTGTCACATCTGATGG - Intergenic
910515110 1:88052441-88052463 CCTGGTGCTGTTGCAGCAAAAGG - Intergenic
911488475 1:98532081-98532103 GCATGTGCTGTCACAGATAAAGG - Intergenic
912966895 1:114243450-114243472 ACATGTGCTGTCTCAACTCAGGG + Intergenic
916320269 1:163498064-163498086 ACATGTGCTGTGTCAGCTCAGGG - Intergenic
916855076 1:168740983-168741005 CCTTGTTCTCTCTCAGGTAAGGG + Intergenic
1067031512 10:42880920-42880942 CCTTGGGCTGGCTCAGCCCAGGG - Intergenic
1068087599 10:52393828-52393850 CCTAATGCTGTCTCAGAAAAAGG - Intergenic
1069556175 10:69399994-69400016 CTGTGTGCTGCCTCAGCTGATGG - Intronic
1070072524 10:73103376-73103398 CCACCTGCTGTCTCAGCTACTGG + Intergenic
1072806275 10:98425678-98425700 CCTGGTTCTGTCCCAGCTGATGG - Exonic
1074088831 10:110227680-110227702 CCTTGGGCTGCCACCGCTAAAGG - Intronic
1074230205 10:111526032-111526054 CCTAGTGCTGTGCCAGGTAATGG - Intergenic
1074495556 10:113977359-113977381 CATTGTGCTGACTAAGGTAAAGG - Intergenic
1078212010 11:9277400-9277422 CATTGTGCTGTCTCACCACATGG + Intergenic
1081785153 11:45741135-45741157 CCTTGAGTTGTGTCAGTTAAAGG - Intergenic
1082574119 11:54781857-54781879 CCTTATCCTGTTTCAGATAAGGG + Intergenic
1083203778 11:61135257-61135279 CCTTCTGCTGTCCCAGCTACAGG + Intronic
1084146411 11:67267265-67267287 CCTTTTGCTGTCCCTGCTCACGG + Intronic
1085169373 11:74435488-74435510 CCTGATGCTGTCTCTGATAAGGG + Intergenic
1085959477 11:81443592-81443614 CCTTATGCAGTTTCAGATAAGGG - Intergenic
1087833100 11:102841000-102841022 CCATTTGCAGTCTCAGTTAAAGG + Intronic
1089097820 11:115934138-115934160 CATTGTGCTGACACACCTAAGGG + Intergenic
1090703440 11:129316028-129316050 CATTCTCCTCTCTCAGCTAAAGG - Intergenic
1094664463 12:32505066-32505088 CCTTGAGCTGTCTGAGATGATGG + Intronic
1095896084 12:47281651-47281673 CCCTGGGGTGTCTCAGCAAAAGG - Intergenic
1096509176 12:52117991-52118013 CCGTGGGGTGTCTCAGCAAAAGG + Intergenic
1100354132 12:93813111-93813133 CCTTCTGCTCTATCAGCTATTGG - Intronic
1102745328 12:115244401-115244423 CCTGGTGCTGTCTTAGCCAGTGG - Intergenic
1104259678 12:127171180-127171202 ACTTGTGCTGTCACAGTTATCGG - Intergenic
1106506518 13:30375466-30375488 CGTTCAGCTGTGTCAGCTAATGG - Intergenic
1107608090 13:42082232-42082254 CCTTGCTCAGTCTCACCTAATGG + Intronic
1108766782 13:53640700-53640722 CCTTTTGCTGTCTAACTTAAGGG + Intergenic
1110768626 13:79308880-79308902 CGTTGTGCTGTCTCTGCTTTTGG + Intergenic
1112372403 13:98805209-98805231 CATTGTGCTGTTTCAATTAAAGG - Exonic
1112815600 13:103269019-103269041 ACTTGTCTTGTCTCAGATAAGGG + Intergenic
1113207034 13:107929048-107929070 CCTTGTTCAGTCTCAGCTGGGGG + Intergenic
1113483670 13:110639345-110639367 CCTAGTGCTGTCTCAGGAGAAGG + Exonic
1115069992 14:29309908-29309930 TCTTGTGCTGCCTCAACTAAGGG - Intergenic
1116142806 14:41021631-41021653 CTCTGTGCTGGCTCAGCCAATGG - Intergenic
1116934945 14:50730244-50730266 TCTTGTGCTGTTTAATCTAAGGG - Intronic
1121877917 14:97470984-97471006 CATTGTGATGACTCAGGTAAGGG + Intergenic
1122919398 14:104873875-104873897 CCTGCTGCTGTCTCAGAGAAAGG - Intronic
1123176406 14:106422990-106423012 CCTTGTGCTGTCAGAGGGAAGGG - Intergenic
1202919375 14_KI270723v1_random:16791-16813 ACTTGTGCTGTGTCAACTCAAGG - Intergenic
1202925257 14_KI270724v1_random:18203-18225 ACTTGTGCTGTGTCAACTCAAGG + Intergenic
1123701025 15:22914932-22914954 CCTTGTGTCATCTCTGCTAAAGG - Intronic
1126214847 15:46143281-46143303 CCTTTTGCTGTCTTTGCAAACGG + Intergenic
1127423662 15:58834123-58834145 ACGTGTGCTGTGTCAACTAAGGG - Intronic
1131306959 15:91253401-91253423 TGCTGTGCTTTCTCAGCTAATGG + Intronic
1139564392 16:67764345-67764367 TCTTGGGCTGACTCAGATAAGGG + Intronic
1140739245 16:77926524-77926546 CATGGTGCAGTCTCAGCTCATGG - Intronic
1141231803 16:82174549-82174571 TTTTGTTATGTCTCAGCTAAGGG + Intergenic
1143716552 17:8775528-8775550 CCTTGGGCTGCTTCAGCTCATGG - Intergenic
1149451120 17:56750735-56750757 CCTAGAGCTGTCTCAGCTCTTGG + Intergenic
1157791969 18:50540953-50540975 CTTTGTACTCTCTCAGCAAAAGG + Intergenic
1158165131 18:54531633-54531655 CCTCGGGCTTTCTCAGCTAAGGG + Intergenic
1159897513 18:74011429-74011451 CCTTCTGCTGTCTCTGCTGATGG + Intergenic
1161860070 19:6791417-6791439 CCTTGAGCTATCTCATCTCAAGG + Intronic
1163225182 19:15955596-15955618 CCTTGCGCTGTCTGAGAGAAGGG + Intergenic
1164765623 19:30764640-30764662 CTTTGTGCTGTGTCATCTCATGG - Intergenic
1165232023 19:34393228-34393250 CCTTGTCCTGTCTCTCCTAGTGG + Exonic
1167535757 19:50050510-50050532 CCTTGTGCTGACTCGGCTCCTGG + Intronic
926361904 2:12096567-12096589 GCTGCTGCTGTCTCAGCTATGGG - Intergenic
926819322 2:16835225-16835247 CCTTATGCTGTCTGAGCAAGTGG + Intergenic
927470541 2:23372589-23372611 CCTTGGGCCTTCTCAGCTACAGG - Intergenic
929442094 2:41972591-41972613 CCTTGTGCTGTCTGTCCTTAGGG + Intergenic
929813612 2:45213073-45213095 CCTTGAGCTGTCTCTGTAAAAGG - Intergenic
930377981 2:50591722-50591744 CCATGTGCTGTCCCAGATAGGGG - Intronic
930909215 2:56610673-56610695 CATTCTCCTGTCTCAGCTAAGGG - Intergenic
932326894 2:70869163-70869185 CCATGTGATGACTCAGCAAAAGG + Intergenic
933109561 2:78379884-78379906 CCTTTTGCTAACTCATCTAAAGG - Intergenic
933980251 2:87543450-87543472 CATTGAGCTGTCTTAGCTTAAGG - Intergenic
936313575 2:111407341-111407363 CATTGAGCTGTCTTAGCTTAAGG + Intergenic
936477541 2:112852416-112852438 CCTCTGGCTTTCTCAGCTAAGGG + Intergenic
937080986 2:119139561-119139583 CCCTGTGCTGCAGCAGCTAAAGG - Intergenic
937510662 2:122591371-122591393 CCTTGTGCTGTCTCTGTTTTTGG + Intergenic
940937882 2:159519797-159519819 CCTTGGCCAGTCTCAGCTACTGG - Intronic
942373645 2:175312794-175312816 TCTTGTTTTGTCTCAGCTATTGG - Intergenic
942770415 2:179511293-179511315 CTTAGTGCTGTCTCTGCTAGAGG - Intronic
944151062 2:196559340-196559362 CGTGGGGATGTCTCAGCTAAAGG + Intronic
944499933 2:200349116-200349138 CCTTCTGCTCTCTCAGCAAGTGG - Intronic
945330061 2:208529270-208529292 AGTGGTGCTGTCTCAGCTCACGG - Intronic
945975145 2:216264584-216264606 CCTTGTGCTGTGTTAGCTGCCGG - Intronic
948168110 2:235878646-235878668 CCATGTGCACTCTCAGTTAAGGG + Intronic
1170135030 20:13063590-13063612 CTATGTGCTGTCTGAGGTAAAGG + Intronic
1170827597 20:19809782-19809804 CCTTGTGAAGTCTCTGCTCAAGG - Intergenic
1171046245 20:21811112-21811134 TCTTGTGGTGTCTCATCAAAGGG - Intergenic
1172539505 20:35699748-35699770 CCTTTTCCTGTCTCAGGTGAGGG + Exonic
1172906910 20:38377218-38377240 CCTTGTCCTGTCTCAGGCAGGGG + Intergenic
1173292753 20:41728799-41728821 CCTTGTGCTGTGTCATCTTATGG - Intergenic
1174158922 20:48536576-48536598 CCTTGTGCTGTCTCACCCTGGGG - Intergenic
1174205483 20:48835194-48835216 CCTGGTGCTGTTTCAGCGCAAGG - Intergenic
1174318995 20:49725860-49725882 GCTGGAGCTGTGTCAGCTAAGGG + Intergenic
1176330815 21:5547094-5547116 CCCTGGGCTGTGTCAGCAAATGG + Intergenic
1176396942 21:6273857-6273879 CCCTGGGCTGTGTCAGCAAATGG - Intergenic
1176440215 21:6715247-6715269 CCCTGGGCTGTGTCAGCAAATGG + Intergenic
1176464477 21:7042316-7042338 CCCTGGGCTGTGTCAGCAAATGG + Intergenic
1176488038 21:7424095-7424117 CCCTGGGCTGTGTCAGCAAATGG + Intergenic
1177175187 21:17695008-17695030 ACATGTGCTGTGTCAGCTCAGGG - Intergenic
1182349594 22:29691908-29691930 CATTGTGGTGTCTGAGATAAAGG + Intronic
953193902 3:40714073-40714095 CCAGGTGCTGTCTCAGGAAATGG - Intergenic
953554349 3:43931496-43931518 CTTTGCTCTGCCTCAGCTAATGG + Intergenic
953958402 3:47248324-47248346 GCTTGTGCTGTCTCTTCTACTGG - Intronic
956274112 3:67479514-67479536 CCTTGTGCTGTCTGGGGAAAAGG - Intronic
956596991 3:70978328-70978350 CATTGTGATGTCTCACCTATAGG + Intronic
957082136 3:75645481-75645503 ACTTGTGCTGTGTCAACTCAAGG + Intergenic
959701749 3:109305434-109305456 CATTGTACTGCCTCAGCTATAGG + Intronic
959701808 3:109305922-109305944 CATTGTACTGCCTCAGCTACAGG + Intronic
959808201 3:110584124-110584146 CATTGTTCTATTTCAGCTAAAGG - Intergenic
960145706 3:114199325-114199347 CTTTGTGCTGTGTCATCTCATGG + Intronic
963863125 3:150330946-150330968 CCTGGTGCTGTCTCTGCTTCAGG + Intergenic
971083999 4:23248980-23249002 TCTTGTGCTTTATCAGATAAGGG + Intergenic
973067679 4:45817790-45817812 CATTTGTCTGTCTCAGCTAAGGG - Intergenic
974597986 4:64037839-64037861 ACATGTGCTGTGTCAGCTCAGGG + Intergenic
978225017 4:106321964-106321986 ACATGTGCTGTGTCCGCTAAGGG + Intronic
978247494 4:106591923-106591945 CTTTGGGCTGTCTCACCTGATGG - Intergenic
978764404 4:112389700-112389722 TCCTGTGCTGTCTCAGGTAAAGG - Intronic
979858483 4:125664430-125664452 CCTTGTGCTGTCTCCCATAGTGG - Intergenic
981433204 4:144686770-144686792 CCATTTGCTGGCTCAGCTTAAGG + Intronic
984341412 4:178461564-178461586 GCTTGTGATTTCTCAGCCAATGG - Intergenic
985888795 5:2700047-2700069 CCCTGTGCTGGCACAGCTAAGGG + Intergenic
986734134 5:10655628-10655650 CCCTGTGCTGTGTCAGCTCCTGG + Intergenic
988056919 5:26109140-26109162 CCTTGTACTGTGTGAGCTTAGGG - Intergenic
988764644 5:34358127-34358149 CCTTGTACTGTCCCAGCTTCTGG - Intergenic
989354589 5:40529317-40529339 CTCTGTGCTGCCTCTGCTAATGG + Intergenic
992762418 5:79962385-79962407 CCTTCTCCTTTCTCAGTTAAAGG + Intergenic
994843896 5:104960317-104960339 CTTTGTGCTGTATCATCTCATGG - Intergenic
995530223 5:113085054-113085076 CCTTGTGCTGTCTCAGCTAAGGG + Intronic
996919977 5:128756724-128756746 CTTTGTGCTGTGACAGCCAATGG + Intronic
997640424 5:135445313-135445335 CCTTGTTCTGCCCCAGCTAGAGG + Exonic
1003601779 6:7524332-7524354 CCTTGTCCACTCTCAGCTCAGGG + Intergenic
1004397580 6:15259465-15259487 CCTGGTGCTGTCACAGCTCTGGG - Intronic
1005558783 6:27015988-27016010 CCTTGTGCTGCTTCAACTAATGG + Intergenic
1014745668 6:125197775-125197797 GCCTGTGCTGTTTCAGGTAATGG - Intronic
1017837771 6:158194725-158194747 CCTCCGGCTTTCTCAGCTAAGGG + Exonic
1018127298 6:160693751-160693773 CCTTGTGCTGACTTACCTAGAGG + Intergenic
1018713344 6:166513403-166513425 CCTTCTTCTGCCTCAACTAACGG + Intronic
1019201199 6:170317524-170317546 CCATGTGTTGTCTCAGATATTGG + Exonic
1021302003 7:18984715-18984737 CTTTTTTCTCTCTCAGCTAATGG - Intronic
1021857328 7:24870207-24870229 TCTTGTGCTGTCTCTCCTACAGG - Intronic
1022757209 7:33304856-33304878 ACATGTGCTGTGTCAGCTCAGGG + Intronic
1023115302 7:36856299-36856321 CCTTGGTGTTTCTCAGCTAAAGG + Intronic
1024946130 7:54809081-54809103 CCTTGTGCAGTTGCAGATAAGGG + Intergenic
1029258217 7:99283768-99283790 CCTTCTGATGCCACAGCTAAAGG + Intergenic
1030328862 7:108251670-108251692 CATGGTGCTGTCTCAACCAAGGG + Intronic
1032557444 7:132851947-132851969 TCTTGTGCTTGCTCAGCTACAGG + Intronic
1035598273 8:878808-878830 CCTTGTGCTGTCTCACAACATGG - Intergenic
1035607968 8:941391-941413 CCTTTTGCTTTGTCAGCCAAGGG + Intergenic
1037171134 8:15893631-15893653 CCTCGTGCTGTTTCAACTCATGG - Intergenic
1040982107 8:53254487-53254509 TCATGTGCTGTTCCAGCTAAAGG + Intergenic
1041173194 8:55166320-55166342 CCTTGTGCTCTGTCAGCAGAAGG - Intronic
1041223165 8:55671704-55671726 CCTTGTGCTGTGTCATTTCATGG - Intergenic
1041391794 8:57353521-57353543 CCTTGTTATGTTTCAGGTAAAGG + Intergenic
1043754832 8:83990097-83990119 GCTTGTGCAGTTTCAGCTGAGGG + Intergenic
1044307950 8:90659236-90659258 TCTTGTGTTGACTCCGCTAAAGG + Intronic
1044933370 8:97271170-97271192 CCTTGTGAAGTCTGACCTAAAGG + Intergenic
1046783267 8:118238555-118238577 CCTTGTGCTGACTCAGCTGTTGG + Intronic
1049609796 8:143549494-143549516 CCTTGCCCTGTCTCAGCAAGTGG - Intergenic
1050331840 9:4553735-4553757 CCTTGAGCAGAATCAGCTAAAGG - Intronic
1050655024 9:7818520-7818542 CTTTGTGCTGTGTCACCTCATGG + Intronic
1052696160 9:31881706-31881728 CCTAGTCCAGTTTCAGCTAAGGG + Intergenic
1054757736 9:68976241-68976263 CCTTTTGCTGTGTAAGCTAATGG - Intronic
1056195186 9:84221846-84221868 GCATGTGCTGTCTTAGCTCATGG + Intergenic
1057909331 9:99005515-99005537 CCCTGTGCTGTCTCTACTATGGG + Intronic
1059180245 9:112205347-112205369 CCTTGTCTTGTTTCAGTTAAGGG + Intergenic
1060776895 9:126381191-126381213 ACTTGTGCTCACTCAGCAAATGG - Intronic
1203431280 Un_GL000195v1:93232-93254 CCCTGGGCTGTGTCAGCAAACGG - Intergenic
1186094509 X:6085069-6085091 CCCTGTTGTTTCTCAGCTAAGGG - Intronic
1187088403 X:16066579-16066601 CCTTATCCTGTGTCAGCTAAAGG + Intergenic
1188052992 X:25509560-25509582 GCTTGTGCTGTCTGAAGTAATGG + Intergenic
1191648677 X:63511377-63511399 CCTTGTGCTGCCAAAGTTAAGGG + Intergenic
1192763460 X:74119752-74119774 CTCTGTGTTGTTTCAGCTAATGG - Intergenic
1194733100 X:97479277-97479299 CCTTGTGCTTTCTACTCTAAAGG + Intronic
1195119982 X:101739531-101739553 ACATGTGCTGTGTCAGCTCAGGG + Intergenic
1197525321 X:127554707-127554729 CCTTCAGCTGCCTCAGCTGAAGG - Intergenic
1198427201 X:136532136-136532158 CCTTGTACAGTCCCAGCTAGAGG + Exonic
1198494398 X:137176907-137176929 CCTTGTGCTGTATCAGGTGCTGG + Intergenic
1199259860 X:145759825-145759847 CCTTGGGCTCTCTCAGGGAAGGG + Intergenic
1201912437 Y:19146461-19146483 CCTCTGGCTTTCTCAGCTAAGGG + Intergenic