ID: 995530901

View in Genome Browser
Species Human (GRCh38)
Location 5:113091107-113091129
Sequence CAGCCTCAGGATTCCTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530901_995530905 21 Left 995530901 5:113091107-113091129 CCACAGAAGGAATCCTGAGGCTG 0: 1
1: 0
2: 4
3: 21
4: 217
Right 995530905 5:113091151-113091173 AAACCAAAACCCCAGACCAGTGG 0: 1
1: 0
2: 3
3: 24
4: 324
995530901_995530908 30 Left 995530901 5:113091107-113091129 CCACAGAAGGAATCCTGAGGCTG 0: 1
1: 0
2: 4
3: 21
4: 217
Right 995530908 5:113091160-113091182 CCCCAGACCAGTGGCACCTTTGG 0: 1
1: 0
2: 1
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530901 Original CRISPR CAGCCTCAGGATTCCTTCTG TGG (reversed) Intronic
900285905 1:1900176-1900198 AACCCTCAAGATCCCTTCTGGGG + Intergenic
900544551 1:3221161-3221183 CAGCCTCAGCATTCGGTCTCTGG + Intronic
903545939 1:24123441-24123463 CAGCCTCACGCTTCCTTCTCTGG - Intronic
904082916 1:27883190-27883212 CAACCTCAGGATTAATTGTGAGG - Intronic
904937862 1:34144512-34144534 CAGCCTCAGGCTTCCCTCACAGG - Intronic
905241970 1:36587285-36587307 CAGCCTCTGACCTCCTTCTGAGG + Intergenic
905493008 1:38360098-38360120 CAGGATCATGCTTCCTTCTGAGG + Intergenic
907572041 1:55492430-55492452 CATCCTCAGGAGTCCTTGGGGGG - Intergenic
909234165 1:73130318-73130340 CTGCCTCAGGTTTCCATTTGGGG - Intergenic
909600790 1:77459064-77459086 CAGCCTCTGGATTCCCTCAGAGG + Intronic
910356201 1:86359290-86359312 CAACCACAGTATTCCTGCTGAGG + Intronic
915885112 1:159713715-159713737 CAGGAGCAGGATTCCTTCGGTGG - Exonic
915895430 1:159808085-159808107 CAGCCTAAGGCCTCCTGCTGGGG - Intronic
918744576 1:188183331-188183353 TAGCCTCAGGGTTCATTGTGTGG + Intergenic
920282565 1:204855051-204855073 GAGTCTCAGGAGTCCTTGTGAGG - Intronic
921014496 1:211176021-211176043 TAGCCTCATGGTTCCTGCTGTGG - Intergenic
921165166 1:212501934-212501956 CAGGCCCAGGAGTCCTTTTGTGG + Intergenic
924833228 1:247620310-247620332 CATCATGAGGATTCCTTCTAAGG + Intergenic
1062942683 10:1435760-1435782 CAGCCTCACGTTGCCTGCTGGGG - Intronic
1062961082 10:1574082-1574104 CAGCCTCAGGATTCCCTGTGTGG - Intronic
1063119439 10:3094425-3094447 CAGCCTCAGGATTTCTTCTTGGG - Intronic
1067217492 10:44315291-44315313 CAGCCTCAGGATGCCTGGAGTGG + Intergenic
1067839605 10:49665321-49665343 CACACTAAGGACTCCTTCTGTGG + Intergenic
1068884836 10:62087589-62087611 CAGCATCAAAATTCCCTCTGGGG - Intronic
1072742284 10:97916598-97916620 CAGCCCCAGGATTCAGACTGAGG + Intronic
1072821818 10:98565957-98565979 CAGCCTCTGGACTTCTTCTTTGG - Intronic
1072951026 10:99846847-99846869 CTGCCTCAGGAATCCATCTCAGG + Intronic
1073149010 10:101299005-101299027 TGGCCTCTGGCTTCCTTCTGGGG + Intergenic
1073541221 10:104317518-104317540 AAGTCCCAGGATTCCTGCTGAGG - Intronic
1075302533 10:121338200-121338222 CCCCTTCAGGATTCCTCCTGCGG + Intergenic
1075566712 10:123510344-123510366 CAACCTCAGGCTTTCTTCTGAGG - Intergenic
1077867954 11:6238899-6238921 AAGACTCAGGCTTCCCTCTGAGG + Intronic
1078287503 11:9972279-9972301 CAGCCTTTAGATTCATTCTGGGG - Intronic
1080432680 11:32213147-32213169 CAGCTCCTGAATTCCTTCTGTGG - Intergenic
1082758594 11:57103682-57103704 CAGCCTCAGGTTTCTTCCAGAGG - Intergenic
1083796322 11:65018811-65018833 CTGCCTCTGGTTTCCCTCTGGGG - Intronic
1084477659 11:69398201-69398223 CCTCCTCAGGATCCCTTCTCAGG + Intergenic
1084477724 11:69398477-69398499 CCTCCTCAGGATTCCTCCTCAGG + Intergenic
1088359315 11:108974422-108974444 TAGTCACAGGATTGCTTCTGGGG + Intergenic
1091012232 11:132012882-132012904 TAGCCTCAGGTTTCTTTCTTAGG + Intronic
1091172809 11:133533218-133533240 AAGCCACAGGTATCCTTCTGTGG - Intergenic
1092441881 12:8511759-8511781 AAGCCTCAGGATTTCTTCAAGGG + Intronic
1096599698 12:52720884-52720906 CAGCCTCAGCAGCCCCTCTGAGG + Intergenic
1097480000 12:60111881-60111903 CTGCCTCAGGTTTTCTTCTTAGG + Intergenic
1097719514 12:63004560-63004582 CTTCCTCAGTATTCCTTCTTTGG + Intergenic
1101641685 12:106589798-106589820 GAGTCACAGGATTCCTTCAGAGG - Intronic
1102255387 12:111411919-111411941 CCTGCTCAGGCTTCCTTCTGGGG - Intronic
1103952689 12:124559518-124559540 CAGCCTCTGGTTTCCTCCTATGG + Intronic
1105640196 13:22254126-22254148 CAGCCCATGGATTCATTCTGTGG - Intergenic
1106129860 13:26931319-26931341 CAACCTCAGGAATCCTGATGTGG - Intergenic
1109648389 13:65291634-65291656 CAAACTCAGGATTTGTTCTGGGG + Intergenic
1111534544 13:89585869-89585891 CTGCCTCCGTCTTCCTTCTGTGG - Intergenic
1112602823 13:100873321-100873343 CATCCTCAGGGTTCATGCTGTGG + Intergenic
1113848751 13:113406237-113406259 CAGCCTCACAAAACCTTCTGAGG - Intergenic
1114601174 14:23956533-23956555 CAGGCTCAGGAGTACTGCTGGGG + Intronic
1114605376 14:23991672-23991694 CAGGCTCAGGAGTACTGCTGGGG + Intronic
1114610861 14:24039303-24039325 CAGGCTCAGGAGTACTGCTGGGG + Intergenic
1114752200 14:25217633-25217655 CTGGCTCAGGATCCCTTATGAGG + Intergenic
1116412960 14:44647164-44647186 CTGCCTCAAGATTTCTTATGAGG - Intergenic
1118872841 14:69757744-69757766 CAGCATCAGGGTTGCTTGTGAGG + Intronic
1122906303 14:104803088-104803110 CTGCCTTAGGATCCCTGCTGGGG - Exonic
1124121445 15:26892376-26892398 CAGCCCCAGGCTCCCTTCTCCGG + Intronic
1124397582 15:29317852-29317874 CAGCCTCCCGCCTCCTTCTGTGG - Intronic
1124665146 15:31586034-31586056 CACCTTCAGAATTCCTGCTGAGG - Intronic
1125023824 15:35010764-35010786 CAGCCTGGGGATTCTTTCTCAGG - Intergenic
1125289756 15:38132707-38132729 CAGCATCAGCATTCCTTAAGTGG - Intergenic
1126792498 15:52233867-52233889 CACCCCGAGGACTCCTTCTGGGG - Intronic
1132576669 16:667426-667448 CAGCCTCAGCATGCACTCTGTGG - Exonic
1132998896 16:2839255-2839277 CAGTCTCAGGCATCCTTGTGTGG - Intronic
1133442486 16:5832333-5832355 CTACCTCAGCCTTCCTTCTGTGG - Intergenic
1135471236 16:22733097-22733119 CAGTCTCTGGTTTCCGTCTGAGG + Intergenic
1136713319 16:32257822-32257844 GAGCCTCAGTGTCCCTTCTGTGG - Intergenic
1136754592 16:32671605-32671627 GAGCCTCAGTGTCCCTTCTGTGG + Intergenic
1136813520 16:33198759-33198781 GAGCCTCAGTGTCCCTTCTGTGG - Intronic
1136819996 16:33308839-33308861 GAGCCTCAGTGTCCCTTCTGTGG - Intergenic
1136826560 16:33365379-33365401 GAGCCTCAGTGTCCCTTCTGTGG - Intergenic
1136831626 16:33464150-33464172 GAGCCTCAGTGTCCCTTCTGTGG - Intergenic
1137028687 16:35502437-35502459 GAGCCTCAGTGTCCCTTCTGTGG + Intergenic
1139466009 16:67154592-67154614 TGGCCTTAGGGTTCCTTCTGCGG - Exonic
1139937515 16:70582220-70582242 CAGGCTCAGGCCTCCCTCTGGGG + Intronic
1141248029 16:82329056-82329078 CAGCCTCAGCCTCACTTCTGTGG + Intergenic
1142042409 16:87903018-87903040 CAGCCTCAGTCTTCCTGGTGGGG + Intronic
1142102857 16:88284837-88284859 CAGCATCAGGAATCCATGTGTGG - Intergenic
1202992097 16_KI270728v1_random:21734-21756 GAGCCTCAGTGTCCCTTCTGTGG - Intergenic
1203056739 16_KI270728v1_random:931940-931962 GAGCCTCAGTGTCCCTTCTGTGG + Intergenic
1142530140 17:573912-573934 CAGCCTCAGGATTCTTTGAAGGG + Intronic
1142535869 17:617361-617383 GAAACTCAGGATTCCTTCAGTGG + Intronic
1142961021 17:3552719-3552741 CAGCCTGACGGTTCCTGCTGAGG + Intronic
1143447785 17:7019201-7019223 CAGCCTTTGGTTTCCGTCTGGGG + Intergenic
1143506399 17:7368115-7368137 CCGCCTCCGGTTTCCTGCTGGGG + Intergenic
1144667372 17:17111377-17111399 CTGCCTCAGGACACCTGCTGGGG - Intronic
1144750683 17:17646213-17646235 GAGGTTCAGGTTTCCTTCTGGGG + Intergenic
1145780014 17:27556786-27556808 CTGCCTCAGGAATCCCTCTAGGG + Intronic
1146138734 17:30346151-30346173 CTGGCTCAGGATTCCTCATGAGG - Intergenic
1147384013 17:40071310-40071332 CAGCCCCAGGAGTCCTTTGGGGG + Intronic
1147391175 17:40110241-40110263 CAGGCTCAGGTTTCATTCTCAGG - Intergenic
1148241507 17:46002307-46002329 CAGCCTCAGCAGCCCTTCTTGGG + Intronic
1148787509 17:50152446-50152468 CAGCCTCAGGATCAGTCCTGCGG - Intergenic
1149338106 17:55658561-55658583 TAGCATCAGGATTCCTTTTAGGG - Intergenic
1149663007 17:58345632-58345654 AAGCCTCAGGATTTCTTCAAGGG + Exonic
1151259356 17:72904606-72904628 CCAACTCAGGATTCCTTCAGTGG - Intronic
1152605185 17:81286031-81286053 CAGCCTCAGGTCAGCTTCTGGGG - Intronic
1152883483 17:82833891-82833913 CAGCCTCAGGTTTCCTTCAGAGG + Intronic
1153784872 18:8525835-8525857 CAGCCTCAGCCTGGCTTCTGTGG - Intergenic
1156783554 18:40881410-40881432 CAGCCCTAGGATTCCTTGTGGGG + Intergenic
1157561428 18:48649121-48649143 CAGCTTCAGCTTGCCTTCTGTGG - Intronic
1157833758 18:50879667-50879689 CAGCCACAGAAGTCCTTTTGTGG - Intronic
1158909307 18:62043703-62043725 AAGCCTTAGGATTCCCTCTAAGG + Exonic
1161152931 19:2719155-2719177 CAGCCTCAGGATCCCATTTATGG - Intronic
1161164934 19:2781610-2781632 AAGCCTCAGTTTTTCTTCTGTGG - Intronic
1161244464 19:3241639-3241661 CAGGCTGAGGCTTCCTTCAGGGG + Intronic
1161816122 19:6501257-6501279 CAGCCTCTGGCTCCCTGCTGGGG + Intronic
1163315051 19:16535829-16535851 CAGCCTCAGCATTCCATCTTCGG + Intronic
1165981900 19:39731448-39731470 CAGCCTCAGGCTTGATTCTATGG + Exonic
1167610632 19:50506307-50506329 CAGCCTGGGCATTCCGTCTGGGG + Intronic
927138842 2:20116002-20116024 CAGCCTCAGCCCTCCTTTTGGGG - Intergenic
930018018 2:46984229-46984251 CAGTAACAGGATTCCTGCTGTGG - Intronic
931772153 2:65506773-65506795 GAGTCTCAGCATTCCTTCTGTGG + Intergenic
932001446 2:67888846-67888868 CAGCCTGGGAGTTCCTTCTGTGG + Intergenic
932897091 2:75650797-75650819 AAGCCTCAGGATTTCTTCAAGGG + Intronic
935814394 2:106833059-106833081 CAGCCACAGCCTTCCCTCTGTGG + Intronic
937978644 2:127597388-127597410 TACCACCAGGATTCCTTCTGCGG + Intronic
938457097 2:131473650-131473672 CAGCCTCAGCCTTCCTTGTAGGG - Intronic
939402019 2:141707024-141707046 CAGCCTCTGTATTTCTTTTGTGG - Intronic
941930711 2:170935928-170935950 CATCCTCAGGATTCTCACTGGGG + Intronic
942168433 2:173265454-173265476 GAGCCTCAGGATCTCTCCTGTGG + Intronic
947571496 2:231239034-231239056 CAGCTTCATGATTCCACCTGGGG - Intronic
947729870 2:232421719-232421741 CAGCCTCAGCTTCCCTTTTGGGG - Intergenic
947846691 2:233250500-233250522 CAGCCTCAGATTACCTTCTAAGG + Intronic
1169021530 20:2334645-2334667 CAGCCACAAGTGTCCTTCTGAGG - Intronic
1169648559 20:7841845-7841867 CAGCCTCAGGATTTCAGCTCAGG + Intergenic
1172530655 20:35628935-35628957 CTGCCTCAGGTTTGCTTCTATGG - Intronic
1173404382 20:42752324-42752346 CATCCTCATGACGCCTTCTGAGG + Intronic
1174169040 20:48604828-48604850 AGGTCTCAGGATTCCTTCTGCGG + Intergenic
1174630014 20:51948536-51948558 CAGCCTCTGCATTAGTTCTGAGG + Intergenic
1175656139 20:60772737-60772759 CCGCCTTAGGATTGCTACTGTGG - Intergenic
1177915249 21:27081056-27081078 CAGCCCCAGCCTTCCTTCTGAGG - Intergenic
1180061046 21:45385243-45385265 CGGCCGCAGGAGTCATTCTGGGG + Intergenic
1181824694 22:25505705-25505727 GGGCTTCAGGATTCTTTCTGGGG - Intergenic
1181986310 22:26802181-26802203 CAGACACAGCATTCCTGCTGGGG + Intergenic
1183064593 22:35354288-35354310 CTCCCTCAGGATCCCTTCTCAGG + Intergenic
1184683557 22:46085805-46085827 CCTCCTGTGGATTCCTTCTGGGG - Intronic
1185002484 22:48254339-48254361 AAGCCACAGGATCCCGTCTGGGG - Intergenic
950648818 3:14394443-14394465 CATTCTCAGGACTCCTTTTGTGG + Intergenic
950687767 3:14630896-14630918 CACCCACAGGATCCCTGCTGGGG - Intergenic
954373458 3:50182411-50182433 CAGCCCCAGGAGCCCTTCCGTGG + Intronic
955085022 3:55694194-55694216 GAGACTCAGGATTTCATCTGGGG + Intronic
955327142 3:58017552-58017574 CAGTGTCAGGATTTATTCTGTGG + Intronic
955534390 3:59907661-59907683 CAACCTCAGGATTCAGCCTGGGG - Intronic
956150755 3:66239889-66239911 CAGCTTCAGGTTTCAGTCTGTGG + Intronic
958758519 3:98278481-98278503 CTGCCTCAGGATCCCGTCTTTGG + Intergenic
959861431 3:111219967-111219989 TAGCCTGAGGAATCCTTCTGAGG - Intronic
960709217 3:120510907-120510929 CAGCCTCAGGGTTCTTTTTTGGG + Intergenic
961312726 3:126014028-126014050 CATGCTGAGCATTCCTTCTGTGG + Intronic
962134221 3:132716816-132716838 CAGCTTCAGCAGTCCTTCAGAGG - Exonic
962455824 3:135564769-135564791 CAGCCTGTGGATTCCTGGTGAGG + Intergenic
964080482 3:152748867-152748889 TAGGTTCATGATTCCTTCTGTGG - Intergenic
965531910 3:169779335-169779357 CAGCGTCAAGAGTCCTTATGAGG + Exonic
965622602 3:170656005-170656027 CAGGCTCAGGCTTCCATCTCAGG + Intronic
966920823 3:184610418-184610440 CAGCCTCAGGAATGTTTCGGGGG + Intronic
967118005 3:186359621-186359643 AATCCTCAGGAGTCCCTCTGAGG - Intronic
968151851 3:196343296-196343318 CAGCCTCAGGAAGCCTTTTGTGG - Intergenic
969510084 4:7612652-7612674 CTGCCTCAGCCTTCTTTCTGGGG + Intronic
970795807 4:19912216-19912238 CAGCCTCAGGTATCATTCTTGGG - Intergenic
971615931 4:28790691-28790713 CCTCCTCAGGCTTCCTCCTGAGG - Intergenic
974505754 4:62769540-62769562 TAGCTTCAGTATTCTTTCTGTGG - Intergenic
975985840 4:80201315-80201337 CAGCCACATGAGACCTTCTGAGG - Exonic
976345216 4:83992764-83992786 CACCCAGAGGTTTCCTTCTGGGG + Intergenic
976395439 4:84550347-84550369 CAGCCCCAGGATTCCCAGTGAGG + Intergenic
976523958 4:86064567-86064589 AAGCCTAAGGCTTCATTCTGAGG + Intronic
977007976 4:91596129-91596151 CAGCCTCAGCACCCCTTCTCTGG - Intronic
977319237 4:95490046-95490068 AGGCCTCAGGACTCCATCTGGGG - Intronic
977993781 4:103477820-103477842 TAGCCTCAGGGTTCCAGCTGGGG + Intergenic
978291059 4:107141193-107141215 CAGCCTCAGACTGCCTGCTGGGG + Intronic
979474419 4:121138364-121138386 CAGAGTCAGAATTCCATCTGGGG - Intronic
983836121 4:172387296-172387318 CAGCCTAAGGTTTCTTTCTTTGG + Intronic
986431324 5:7683923-7683945 CAGCCTTTGGATTTCTTCTGAGG - Intronic
987066571 5:14295876-14295898 CAGCCTCAGGGTTACATCTCCGG - Intronic
988563854 5:32304797-32304819 GAGCCTCATGATGCTTTCTGAGG + Intronic
989491580 5:42061473-42061495 CTGCCTCAACATGCCTTCTGTGG - Intergenic
993607284 5:90007086-90007108 CAGCCTCATGATTCATTCAGTGG - Intergenic
995530901 5:113091107-113091129 CAGCCTCAGGATTCCTTCTGTGG - Intronic
996047330 5:118888002-118888024 CAGCCTCAGAATTCTTGCTGGGG - Intronic
1000451786 5:161398609-161398631 CAGCCTAAGGATGGCTGCTGTGG - Intronic
1002605043 5:180377948-180377970 CAGCCACAGGAATCCCTCCGAGG + Intergenic
1002954085 6:1844960-1844982 AAACCTAAGGATTTCTTCTGAGG - Intronic
1003478151 6:6504427-6504449 CAGACTCACAATCCCTTCTGTGG - Intergenic
1004536203 6:16504865-16504887 GAGGCTCAGGAGTCCTCCTGGGG + Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006140307 6:31925013-31925035 CAGTCTCAGGACAACTTCTGAGG - Intronic
1006505743 6:34487620-34487642 CAGCTTCAGGGTTCCATGTGGGG - Intronic
1007253525 6:40512657-40512679 CAGACCCTGGATTCCTCCTGGGG + Intronic
1007606171 6:43119656-43119678 CAGCCTCAGGAAGACCTCTGTGG - Intronic
1008060026 6:46987129-46987151 CAGCCTCAGGTATCTTTTTGTGG - Intergenic
1012909639 6:105104498-105104520 CATCCTCAGGATCCTTTCTGAGG - Intronic
1014266945 6:119289870-119289892 TAGCCTCAGCATTCCGGCTGGGG - Intronic
1015181893 6:130369582-130369604 AAGCCCCAGAATTCCTGCTGGGG - Intronic
1015907824 6:138135925-138135947 CAGCCTCAGGTATTCCTCTGTGG + Intergenic
1019659028 7:2213567-2213589 CAACCCCAGGATCCTTTCTGAGG - Intronic
1021648120 7:22806835-22806857 CAGCCGGAGGTTTCCTTTTGGGG + Intergenic
1021742257 7:23698848-23698870 CAGCCTTAAAATTCCTTGTGGGG - Intronic
1025142128 7:56475186-56475208 CAGCCTCAGGCCTGCTTCTGAGG + Intergenic
1025611352 7:63077859-63077881 CAGCCTCAGGCCTGCTTCTCAGG - Intergenic
1025708275 7:63886614-63886636 CAGCCTCAGGCCTGCTTCTGAGG + Intergenic
1026220283 7:68390373-68390395 CAGCCTTGTGCTTCCTTCTGAGG - Intergenic
1029845555 7:103408594-103408616 CAGCTTCAGGGTTCCTTTTCTGG - Intronic
1031363161 7:120871313-120871335 CAGCATCAGGATTGTTTCAGGGG - Intergenic
1032458945 7:132095138-132095160 CATCCCCAGCATCCCTTCTGTGG + Intergenic
1033658649 7:143389410-143389432 CACTTTCAGGATTCCATCTGGGG + Intronic
1034450909 7:151136854-151136876 CCGCCTCAGGAAACCTTCCGGGG - Intronic
1036152021 8:6307820-6307842 CAGGCTCAAGCTGCCTTCTGAGG - Intergenic
1036441905 8:8789149-8789171 CAGCCTCGGGCTTCCCTCTAGGG - Intronic
1037995145 8:23346825-23346847 CACCCTCAGGATGACTTCTCAGG - Intronic
1038397353 8:27257112-27257134 GAGACTCTGGCTTCCTTCTGTGG + Intronic
1039061773 8:33577501-33577523 CTGCCTCAGGATCCCTTCTGAGG - Intergenic
1039320393 8:36423935-36423957 CAGCCTCAGGGTCTCTTGTGAGG + Intergenic
1039769787 8:40673765-40673787 TAGCGTGAGGATTACTTCTGTGG - Intronic
1044728824 8:95214190-95214212 CACCCTCAGTATCCCTTCTGGGG + Intergenic
1044776410 8:95693510-95693532 CAGCCACAGGATTCCACCTGCGG - Intergenic
1046293582 8:112193854-112193876 CTGCCATAGCATTCCTTCTGAGG - Intergenic
1047796099 8:128257553-128257575 CAGCGGCAGGATTCCCTGTGGGG - Intergenic
1048363950 8:133721975-133721997 CAGCCTCACAATTCTTACTGGGG + Intergenic
1049449886 8:142654946-142654968 CAGCCTCGGGGTCCCTTCTGAGG + Intergenic
1052764397 9:32625984-32626006 CAGCCTATGCATTCCTTCAGGGG + Intergenic
1053350980 9:37413069-37413091 CAGCCTCAGGTTTCCTCCCTGGG - Intergenic
1053461775 9:38277054-38277076 CAGACTCAGGGTTTCTTCCGGGG + Intergenic
1054863420 9:69975812-69975834 AAACCTCAGGACTCCTGCTGGGG - Intergenic
1056106198 9:83349123-83349145 CAGCTTCAGCGTACCTTCTGGGG - Intronic
1057979869 9:99650136-99650158 CAGCCTCCAGGTACCTTCTGGGG + Intergenic
1059248396 9:112867149-112867171 CTACCTCAGGATTCCTTCTCAGG + Intronic
1062444599 9:136588331-136588353 CAGTCTCAGGAAAGCTTCTGGGG + Intergenic
1186719014 X:12282508-12282530 GTGCCACAGGATACCTTCTGTGG - Intronic
1186825860 X:13339676-13339698 CAGCTTCCAGATTCTTTCTGAGG + Intergenic
1187329465 X:18323546-18323568 CAGATTCAGAACTCCTTCTGGGG - Intronic
1188615760 X:32157216-32157238 CAGACTGAGGATTCCTTCAGTGG - Intronic
1189487683 X:41445714-41445736 CAGCCTCTGGACTGCTGCTGGGG + Intergenic
1189632528 X:42970012-42970034 CAGCATTAGGATTCCTCCTAGGG + Intergenic
1190741780 X:53293496-53293518 CAGCAACAAGATTGCTTCTGAGG + Intronic
1192316124 X:70053173-70053195 CAGCCCCAGGCTTTCTTCTTTGG - Intergenic
1195589152 X:106603718-106603740 CAGTTTCATTATTCCTTCTGTGG - Intergenic
1198097878 X:133398423-133398445 CAGCCTCAGGGTTCCTCATTAGG + Intronic
1198243964 X:134811415-134811437 CAGCCTCAAGACTCCATCTCAGG - Intronic
1200019261 X:153188242-153188264 AAGCCACAGGAGTCCATCTGAGG - Intergenic