ID: 995530910

View in Genome Browser
Species Human (GRCh38)
Location 5:113091161-113091183
Sequence CCCAGACCAGTGGCACCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995530904_995530910 -6 Left 995530904 5:113091144-113091166 CCTTCAGAAACCAAAACCCCAGA 0: 1
1: 0
2: 2
3: 33
4: 355
Right 995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 158
995530903_995530910 18 Left 995530903 5:113091120-113091142 CCTGAGGCTGTGCAGCGGAGTCA 0: 1
1: 0
2: 1
3: 16
4: 179
Right 995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG 0: 1
1: 0
2: 1
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995530910 Original CRISPR CCCAGACCAGTGGCACCTTT GGG Intronic
900370452 1:2329783-2329805 CCCAGCCCAGTGGGGCCTTGGGG - Intronic
900384096 1:2401434-2401456 CCCAGCCTTGTGGCTCCTTTTGG + Intronic
902686029 1:18078232-18078254 CCCAGAGCAGGGCCCCCTTTGGG - Intergenic
904499901 1:30907923-30907945 CCCAGACCATGGCCACTTTTTGG - Intronic
905370888 1:37482212-37482234 CACAGCCCATGGGCACCTTTAGG - Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
913663717 1:121028849-121028871 CCCAGACAAGTCATACCTTTAGG + Intergenic
914015115 1:143812129-143812151 CCCAGACAAGTCATACCTTTAGG + Intergenic
914162706 1:145149096-145149118 CCCAGACAAGTCATACCTTTAGG - Intergenic
914653732 1:149720669-149720691 CCCAGACAAGTCATACCTTTAGG + Intergenic
914899928 1:151706445-151706467 CCCAGGCCAGTGGCACCTGCAGG + Intronic
920086610 1:203422142-203422164 CCCAGGCCAGTGGCTGCTGTAGG - Intergenic
923889354 1:238194878-238194900 CCAAGATCAGTGGAACCTCTAGG + Intergenic
924432995 1:244013225-244013247 CCCAGCCCAAAGGCAGCTTTTGG - Intergenic
1062799999 10:371781-371803 CCCAGCCCTGTGACACCTTGGGG + Intronic
1064015066 10:11765303-11765325 ACCAGCCCAGTGGCCCCCTTCGG - Intergenic
1066561238 10:36672068-36672090 CCCAGACCTGTCACAACTTTTGG - Intergenic
1069782908 10:70967992-70968014 CCCAGTTCATTAGCACCTTTTGG + Intergenic
1071256378 10:83875550-83875572 CACAGACTTGGGGCACCTTTTGG - Intergenic
1072551166 10:96478769-96478791 GTCAGACCAGTGGCTACTTTGGG + Intronic
1073026026 10:100487923-100487945 CCCAGGTCAGTGACACCTATGGG + Intronic
1077526432 11:3068438-3068460 CCCAAATCAATGGCACTTTTGGG + Intergenic
1078201930 11:9191183-9191205 CCCAGAACAGAGGGAACTTTTGG + Intronic
1079361351 11:19773047-19773069 GAAACACCAGTGGCACCTTTTGG + Intronic
1080098561 11:28432887-28432909 CCCAGAGCACTGGCTCATTTTGG + Intergenic
1081155263 11:39682072-39682094 CCCTGACCTGTGGAATCTTTTGG + Intergenic
1081783215 11:45727865-45727887 CCCAGACCAGTGGCCCTTTGTGG - Intergenic
1083582256 11:63832491-63832513 ACCAGACCAGTGCCACCACTGGG - Intergenic
1084775960 11:71375704-71375726 CCCAAACCAGGGGCTCCCTTGGG - Intergenic
1085530710 11:77190498-77190520 CCCACCCCAATGGGACCTTTAGG - Intronic
1088751563 11:112846491-112846513 CTTAGGCCAGTGGCACCTTCTGG - Intergenic
1090420952 11:126574593-126574615 CCCAGAGAAGTGACCCCTTTTGG + Intronic
1091773307 12:3167919-3167941 CCCATCCCACTGGCTCCTTTGGG + Intronic
1092618376 12:10236251-10236273 CCCAGCCCACTGTTACCTTTTGG - Intergenic
1093923317 12:24883868-24883890 CTCAGATCAGTGGCAGCATTAGG - Intronic
1094213623 12:27918571-27918593 CCAAGAACAGGGGCAGCTTTGGG + Intergenic
1100514198 12:95310778-95310800 CCCAGACAACTGCCATCTTTTGG - Intergenic
1101227553 12:102705022-102705044 CCCTGACCATTAGCATCTTTAGG + Intergenic
1101550739 12:105759284-105759306 CCAAGACCAGAGGCAACGTTGGG - Intergenic
1102455225 12:113066769-113066791 CCCAGAACAGAAGCACCTTGAGG - Intronic
1103237956 12:119389707-119389729 CCCAGACCCAAGGCATCTTTAGG + Intronic
1106304361 13:28496310-28496332 CCCAGAAATGTGGCAACTTTGGG - Intergenic
1106354065 13:28962853-28962875 CCCTGATCAGTGTCACTTTTGGG + Intronic
1107619923 13:42216600-42216622 TCCAGAAAAGTGCCACCTTTGGG + Intronic
1107773284 13:43811253-43811275 CCCAGAGCAATGGCACATTTGGG - Intergenic
1108045440 13:46379426-46379448 CCCAGACCAGTGGCAATAATAGG + Intronic
1108450021 13:50551976-50551998 CCAACTCCAGTGGCACATTTGGG - Intronic
1108460679 13:50664706-50664728 CCCACACCAGTGGCACAGATGGG - Intronic
1113671879 13:112181185-112181207 CCCAGAGCACTGGCCACTTTGGG - Intergenic
1115499865 14:34039916-34039938 CACAGTCCAGTGGCATGTTTTGG - Intronic
1115979231 14:39030694-39030716 CCCAGATCAGTGGGGCCTTCAGG + Intergenic
1117078588 14:52128570-52128592 CCCAGACCGGTAGCATCTGTTGG + Intergenic
1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG + Intronic
1119797427 14:77411672-77411694 CAAAGACAAGTGGCAACTTTTGG + Intronic
1122429313 14:101629894-101629916 CCCAGCCCAGGGCCACCCTTTGG + Intergenic
1124127772 15:26953128-26953150 CCCAGACAATTGTCACCTTGTGG - Intergenic
1127846661 15:62876727-62876749 CCCAGACCAGTGGTAAATGTTGG + Intergenic
1128786765 15:70403399-70403421 CATAGTTCAGTGGCACCTTTTGG - Intergenic
1129759383 15:78120728-78120750 CCCAGCTCTGTGGCAACTTTGGG - Intronic
1138605369 16:58085137-58085159 CCCACCCCAGTGACAGCTTTAGG + Intergenic
1139339070 16:66255790-66255812 CCAGGACCAGTGGCACATTCTGG + Intergenic
1141912717 16:87070935-87070957 CCCAGGCCAGTTGCAGCTTGGGG + Intergenic
1144956398 17:19020985-19021007 CCCAGAGCCTGGGCACCTTTGGG - Exonic
1146252553 17:31362041-31362063 CCCAGACCAGCAGCATCATTTGG + Intronic
1147536124 17:41324219-41324241 ACCAGACCATCGGCTCCTTTGGG - Intergenic
1149921468 17:60664280-60664302 CCCAGACCAATGGCATTATTAGG + Exonic
1151442258 17:74137609-74137631 CCCAGACCTGTGTGAACTTTAGG - Intergenic
1151494410 17:74450851-74450873 CCCAGCCCAGCAGCACCTCTGGG + Intronic
1152549371 17:81021661-81021683 CCCAACCCAGGGGCACCTTTTGG - Intergenic
1152647160 17:81474706-81474728 CCGATACCAGTGGCAGCTTGGGG + Intergenic
1153107964 18:1550010-1550032 GCCTGACCTGTGGCTCCTTTTGG - Intergenic
1155360499 18:24995179-24995201 CACAGACCACTGGCATCTTTTGG - Intergenic
1155464874 18:26122798-26122820 CACAGACCAGTGACACCATGAGG + Intergenic
1156456189 18:37295889-37295911 CCCACACAAGTGACACCATTGGG - Intronic
1157490588 18:48121025-48121047 CCAAGACCAGGGGCAGCTCTGGG - Intronic
1158651267 18:59288644-59288666 CCATGACCAGTGGAACATTTTGG + Intronic
1159257897 18:65972618-65972640 CCCAGACCATCAGCACCTGTAGG - Intergenic
1159334418 18:67044360-67044382 CCCAGGCCTGTGACACCCTTTGG + Intergenic
1159943567 18:74426870-74426892 CCCAGACCAGGGGCTCCTCAGGG - Intergenic
1160385269 18:78492996-78493018 CCCAGTGCAGTGGCCCCCTTGGG - Intergenic
1160899772 19:1421844-1421866 CCCAGGCCCGTGGCACCCTCAGG - Intronic
1161263543 19:3351620-3351642 CCCAGACCACTGACAATTTTTGG + Intergenic
1162785143 19:13030099-13030121 CGCAGACCAGTGGCATTTCTGGG - Intronic
1163773546 19:19205074-19205096 CCCAGATCAGGGGCTCCTCTGGG - Intergenic
1164959591 19:32416447-32416469 CACACACCAGTGGCACGTTTGGG + Intronic
1167516235 19:49924629-49924651 CCCAGGCCTGTGGCCCCTTCAGG - Intronic
925265489 2:2563692-2563714 CCCAGGCTGGTGCCACCTTTGGG - Intergenic
926735411 2:16070016-16070038 CCCAGAAAAGTGGAAGCTTTGGG - Intergenic
929450002 2:42030479-42030501 CCCAGACCAGAGGGGCCTTGGGG + Intergenic
931662339 2:64577598-64577620 TCTAGATCAGTGACACCTTTGGG - Intronic
934667243 2:96181026-96181048 CCCAGACCATTGAAACCTCTAGG - Intergenic
936679282 2:114752107-114752129 CCCTGACCATTGGCATCATTTGG - Intronic
938342445 2:130544533-130544555 CCCAGACCAGTTGCTCCTTGAGG - Intronic
938347387 2:130576176-130576198 CCCAGACCAGTTGCTCCTTGAGG + Intronic
940790080 2:158022963-158022985 CTCAGAGCAGTGGCACCTGGGGG + Intronic
942668172 2:178344432-178344454 CACACACCAGTGGCACCATCAGG - Intronic
944889055 2:204098275-204098297 GCCAAGCCAGTGGCACCATTTGG - Intergenic
946400175 2:219464457-219464479 CCCAGACCAGCGGCGCTTTGCGG + Exonic
947145488 2:227060201-227060223 CTCAGCCCAGGGGCACCTTGGGG + Exonic
948732650 2:239976872-239976894 CCCAGAACACTGGCAACTTCTGG + Intronic
1169146895 20:3258612-3258634 CCCAGACCTGTAGCACCACTTGG + Intronic
1170189696 20:13632634-13632656 CCCAGTCCAGTGGAACTTTAGGG - Intronic
1170611231 20:17915243-17915265 ACCAGACCAGTGGGACTCTTGGG + Intergenic
1171386588 20:24773524-24773546 GCCAGACCTGTGGCTCATTTGGG + Intergenic
1172267801 20:33631946-33631968 ATCAGACCAGTGGCACTTTTTGG - Intronic
1172733467 20:37108410-37108432 CCCAGTCCAGTTTCCCCTTTAGG - Intronic
1175917406 20:62433109-62433131 CTCAGCCCAGAGGAACCTTTAGG - Intergenic
1176274628 20:64256844-64256866 GCCAGACCAGTGGTACATGTTGG - Intronic
1176885150 21:14246323-14246345 CCCATACCATAGGCACCATTAGG + Intergenic
1182331359 22:29553573-29553595 CCCAGCCCAGGGGCGCCCTTTGG + Intronic
1184474216 22:44711867-44711889 CCCAGCCCTGTGGCAGCTGTTGG - Intronic
1184855877 22:47146458-47146480 CCCAGACCCGTGGCTCCTTTGGG + Intronic
950636776 3:14321134-14321156 CCCAGCACATTGGCACATTTTGG + Intergenic
954278993 3:49562371-49562393 CCCACACCATGGGCCCCTTTAGG - Intronic
955648274 3:61164326-61164348 CCCAGACCAGCAGTACCTCTTGG + Intronic
962966399 3:140358274-140358296 CCCAGCCCAGAGCCACCTCTGGG - Intronic
967824312 3:193866615-193866637 CACAGACCAGTGGTGGCTTTGGG - Intergenic
967929379 3:194679668-194679690 CCCAGACCAGGGCCCTCTTTAGG - Intergenic
968941312 4:3640265-3640287 CCCTGAGCACTGGCACCCTTCGG - Intergenic
972721109 4:41699867-41699889 CCCAGAGCAGTAACATCTTTTGG - Exonic
974490658 4:62559332-62559354 CCCAGACAAGAGGCATCTATCGG - Intergenic
975194432 4:71507151-71507173 CACAGACCAGTGACACCATAAGG + Intronic
978105337 4:104895459-104895481 TCCAGACCAGGGCCACCTCTGGG + Intergenic
978525260 4:109658618-109658640 CCCAGACCAGGAGCATCTTGGGG - Intronic
978923702 4:114217315-114217337 CCCACAGCAGTGGCACCATAGGG - Intergenic
984973776 4:185211900-185211922 CCCAGCTCACTGGCACCTCTGGG + Intronic
995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG + Intronic
999664819 5:153901716-153901738 CCCAGCCCAGTGGAGCCTTCAGG + Intergenic
1001586359 5:172835711-172835733 CCAAGACCAGTGTCCTCTTTGGG - Intronic
1003419227 6:5940626-5940648 GCTGGACCACTGGCACCTTTAGG - Intergenic
1004345835 6:14848469-14848491 CCCAGCCCAGTTTAACCTTTTGG - Intergenic
1005510685 6:26509154-26509176 CCCAGCCAAGGGGCACCTTAAGG + Exonic
1005809836 6:29507016-29507038 CCCAGTCCACTGGCACCCTGAGG - Intergenic
1006184555 6:32173728-32173750 CACAGCTCAGTGTCACCTTTTGG + Intronic
1006417607 6:33913876-33913898 CTCAGACCAGTGTCAGCTTGAGG - Intergenic
1018728545 6:166631859-166631881 CCCAGACAGGTGGCACCTCAGGG + Intronic
1019302169 7:311313-311335 CCCAGACCAGGGGCACCAGATGG + Intergenic
1019341306 7:510334-510356 GCCACACCAGGGGCACCTTGTGG + Intronic
1022521310 7:31008868-31008890 CCAAGCCCAGTGCCTCCTTTAGG + Intergenic
1023793328 7:43770957-43770979 CCCAGGCCAGTGTCTACTTTGGG - Intronic
1025142518 7:56477989-56478011 CCCAGACCCGTGGAGCCCTTAGG + Intergenic
1025610872 7:63074611-63074633 CCCAGACCCGTGGAGCCCTTAGG - Intergenic
1025708577 7:63888597-63888619 CCCAGACCCGTGGAGCCCTTAGG + Intergenic
1025853879 7:65262290-65262312 CCCAGACCAGGGTCACATTTAGG + Intergenic
1029452650 7:100649828-100649850 GCCAGATCAGCGGCCCCTTTCGG - Intronic
1029582875 7:101449048-101449070 CCAGGACCAGAGGCACCTGTCGG - Intronic
1032478162 7:132226317-132226339 CCCTGACCAGTGACACCTGCTGG + Intronic
1037315397 8:17595329-17595351 CCCAGACCCTGGGCACCTTTGGG - Intronic
1039402815 8:37285677-37285699 GCCAGACCACTTCCACCTTTTGG - Intergenic
1041028919 8:53716548-53716570 CCCAGACCAGTAGCTCCTGATGG - Intronic
1041564596 8:59262321-59262343 CTCTCACCAGTGGCACCTTCTGG + Intergenic
1043755765 8:84001117-84001139 CCCAGAACACTGGAACGTTTTGG + Intergenic
1048060002 8:130909193-130909215 TGCAGACCACTAGCACCTTTGGG + Intronic
1049100154 8:140573505-140573527 GCAAGACCTGTGGCTCCTTTGGG + Intronic
1056730773 9:89164428-89164450 CCCAAACCAGTTGCACTTTTGGG - Intronic
1060741331 9:126099501-126099523 CCCAGGGCAGTGCCACCTTCTGG + Intergenic
1061529239 9:131197371-131197393 AGCAGACCTGTGGCACCTTCTGG + Exonic
1061608197 9:131727544-131727566 CCTGGACCTGTGGCATCTTTGGG - Intronic
1062275285 9:135727563-135727585 CCCAGCCGTGTGTCACCTTTGGG + Intronic
1062339359 9:136087141-136087163 CCCAGGACAGTGGCAGCCTTGGG + Intronic
1062376988 9:136266332-136266354 CCCAGGCCAGTGGGTCCTCTGGG + Intergenic
1193879839 X:86908470-86908492 CACAGACCTGAGGCACCTGTGGG + Intergenic
1196194507 X:112825539-112825561 CCAAAACCACTGTCACCTTTAGG + Intronic
1197782646 X:130172612-130172634 CCCCGAGCAGCGGCACCTGTGGG + Intronic
1199950007 X:152699558-152699580 TCCAGATCAGTGGCAACCTTGGG + Intronic
1199952198 X:152715431-152715453 TCCAGATCAGTGGCAACCTTGGG + Intronic
1199954836 X:152734624-152734646 TCCAGATCAGTGGCAACCTTGGG + Intronic
1199957485 X:152753017-152753039 TCCAGATCAGTGGCAACCTTGGG - Intronic
1199959667 X:152768903-152768925 TCCAGATCAGTGGCAACCTTGGG - Intronic
1200041690 X:153375500-153375522 CCCAGCCCAGTGAGAACTTTGGG + Intergenic
1201789658 Y:17825506-17825528 CCCAGACTAGTGGAACATTTTGG - Intergenic
1201811896 Y:18080483-18080505 CCCAGACTAGTGGAACATTTTGG + Intergenic
1202351309 Y:23995256-23995278 CCCAGGCTAGTGGAACATTTTGG - Intergenic
1202519470 Y:25674863-25674885 CCCAGGCTAGTGGAACATTTTGG + Intergenic