ID: 995540876

View in Genome Browser
Species Human (GRCh38)
Location 5:113184980-113185002
Sequence TGACCCTTTCAGTTAAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995540876_995540882 13 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540882 5:113185016-113185038 TGCAAAGGCACCAGGGAAGCTGG 0: 1
1: 0
2: 2
3: 39
4: 329
995540876_995540880 5 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540880 5:113185008-113185030 GAAAAGGCTGCAAAGGCACCAGG No data
995540876_995540884 15 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540884 5:113185018-113185040 CAAAGGCACCAGGGAAGCTGGGG 0: 1
1: 0
2: 4
3: 37
4: 560
995540876_995540883 14 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540883 5:113185017-113185039 GCAAAGGCACCAGGGAAGCTGGG 0: 1
1: 0
2: 1
3: 31
4: 318
995540876_995540881 6 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540881 5:113185009-113185031 AAAAGGCTGCAAAGGCACCAGGG 0: 1
1: 0
2: 1
3: 20
4: 294
995540876_995540886 27 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540886 5:113185030-113185052 GGAAGCTGGGGAAATCCTGAAGG 0: 1
1: 0
2: 5
3: 31
4: 252
995540876_995540879 -2 Left 995540876 5:113184980-113185002 CCACCTTTTAACTGAAAGGGTCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 995540879 5:113185001-113185023 CAAGAGAGAAAAGGCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995540876 Original CRISPR TGACCCTTTCAGTTAAAAGG TGG (reversed) Intronic
903841250 1:26242750-26242772 TCACACTTTAAGTTAAATGGAGG + Intronic
908914730 1:69113054-69113076 TGACCCTTTCAGTTTACCTGAGG + Intergenic
915511940 1:156391303-156391325 TGAGCCTTGCAGAGAAAAGGAGG + Intergenic
917699079 1:177561723-177561745 TGACACTTTCAGGTAAATGATGG - Intergenic
917771660 1:178286200-178286222 GGACCCCTTCAGAGAAAAGGTGG - Intronic
919517321 1:198542120-198542142 TTACTCTCTCAGTGAAAAGGAGG + Intergenic
921540501 1:216408649-216408671 TTACCTTTTCACTTAAAAGAGGG + Intronic
923278830 1:232421784-232421806 TGCCCCTTGAAGTTAAAAAGTGG - Intronic
923582820 1:235234489-235234511 TCACCCTTTTTCTTAAAAGGTGG - Exonic
1063077730 10:2733297-2733319 TGACCCTTGCAGGTAAACTGAGG - Intergenic
1064806326 10:19138006-19138028 AGAGCTTTTCACTTAAAAGGTGG - Intronic
1066184183 10:32993015-32993037 TGACCCTTTCAGGCAAATGTGGG - Intronic
1066636104 10:37503065-37503087 TGTTCTTTTCAGTGAAAAGGAGG - Intergenic
1070158228 10:73849579-73849601 AGACCTTTCCAGTCAAAAGGGGG - Intronic
1074377193 10:112950321-112950343 AGAGCTTTTCAGTTCAAAGGCGG - Intronic
1077717642 11:4597958-4597980 TGCCCCTTTTAGATAAAAGCAGG + Intergenic
1081434277 11:43009982-43010004 TAAACCTCTCAGTCAAAAGGGGG + Intergenic
1084289072 11:68150302-68150324 TCACCCTTTCAGATAACAAGAGG + Intergenic
1085211500 11:74783973-74783995 TGAGACTTTGATTTAAAAGGGGG + Intronic
1086382130 11:86266322-86266344 TGTCCCTTAAAGTTAAAAGAAGG - Intronic
1089161422 11:116440456-116440478 GGACCCTTAGAGGTAAAAGGAGG - Intergenic
1089982638 11:122785095-122785117 TTACCCTTTGAGTTAACTGGAGG - Intronic
1092213887 12:6667123-6667145 TGCCCCCTTCAAATAAAAGGAGG + Exonic
1097165626 12:57084521-57084543 GGACCCTCTCAGTTGAAAGATGG - Intronic
1100026970 12:90141678-90141700 TGAACACTTCAATTAAAAGGTGG - Intergenic
1100842454 12:98627390-98627412 TTACCATTAGAGTTAAAAGGAGG - Intronic
1103585525 12:121951512-121951534 TCACTTTTTCAGTTAAAAGTGGG - Exonic
1106761276 13:32870312-32870334 TGTCATTTTCTGTTAAAAGGTGG - Intergenic
1113209920 13:107965194-107965216 TTATCTTTTCAATTAAAAGGTGG + Intergenic
1115806220 14:37055051-37055073 TGACGCTTGCAGTCACAAGGGGG - Intronic
1116366842 14:44077217-44077239 TTACCATTTCTGTTAAATGGAGG + Intergenic
1118127255 14:62920381-62920403 TGAACCTTTCAGGTTAAAGCAGG + Intronic
1120080561 14:80211519-80211541 TCACCCTCTTATTTAAAAGGGGG + Intronic
1131850384 15:96536833-96536855 TTAAGCTTTCATTTAAAAGGGGG - Intergenic
1135034751 16:19067726-19067748 GGTCCCTCTCAGGTAAAAGGAGG + Exonic
1138067155 16:53954312-53954334 TGGGCCTTTCATTTAAAAGGAGG + Intronic
1141482709 16:84317562-84317584 TGACTCTTTCTGTTAAAACCAGG + Intronic
1143776747 17:9204585-9204607 CAACCCTTTCAGTTCCAAGGGGG + Intronic
1143967717 17:10768652-10768674 TCACTCTCTCAGTTTAAAGGTGG + Intergenic
1147632120 17:41938905-41938927 TTACCCTGTCAGCTAAGAGGAGG + Intronic
1148579280 17:48732752-48732774 TGTCCTTTTCAGGTAAAAGCAGG - Intergenic
1152326469 17:79642835-79642857 TAAATCTTTCAGTTAAAAGGTGG + Intergenic
1155642852 18:28040534-28040556 TGAACATTTCTGTTAACAGGAGG - Intronic
1156670889 18:39468035-39468057 TGACACTTTCTTTTACAAGGAGG - Intergenic
1157124826 18:44946379-44946401 TCACCCTAGCAGTTGAAAGGTGG - Intronic
1157233286 18:45939411-45939433 AGACCATTTCAGTCAACAGGTGG + Intronic
1158843019 18:61408812-61408834 TGACTTTTTGAGTAAAAAGGTGG - Intronic
1163235726 19:16029364-16029386 TGACCATTTCAGTCAAAAACAGG - Intergenic
1166278849 19:41776288-41776310 TAACCCTTTCAGTTATATGTTGG + Intergenic
926851266 2:17200126-17200148 TTTCCCTTTCAGTCAAATGGGGG + Intergenic
928400821 2:30977567-30977589 TTCCCCTTTCAGGTGAAAGGAGG - Intronic
929292923 2:40213940-40213962 TGACCCATTTAATTGAAAGGTGG - Intronic
929983931 2:46707185-46707207 TGTGCCTGTCAGTCAAAAGGTGG + Intronic
931970335 2:67578846-67578868 TGACCCTTTCAATGAAATGGGGG - Intergenic
935584438 2:104788058-104788080 TGAGCATTTCAGATAAAAGTTGG - Intergenic
939608819 2:144285385-144285407 GGACCCTTTCAGTGAATGGGAGG - Intronic
942100496 2:172577392-172577414 TGAACATTCCAATTAAAAGGTGG - Intronic
945271756 2:207947773-207947795 TAACCCTTTCCATTACAAGGAGG + Intronic
945326306 2:208486557-208486579 TTACCCTTTCATCTTAAAGGAGG + Intronic
1172169585 20:32920898-32920920 ACACCCTTCCAGTTAACAGGAGG - Intronic
1174061186 20:47834115-47834137 TGACCCTCTGACTTAAATGGTGG + Intergenic
1174070590 20:47896584-47896606 TGACCCTCTGACTTAAATGGTGG - Intergenic
1174785258 20:53426526-53426548 TGACCTTCTCTGTTAAGAGGGGG - Intronic
1180081697 21:45490263-45490285 TGACCCTTTCAGGGAGAAGTTGG + Exonic
1181024422 22:20119913-20119935 TGACGCTTTCAGTTAAGAGCTGG + Intronic
1184235649 22:43181712-43181734 TGTCCCTTTCATTTTAAAAGGGG - Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957824368 3:85422070-85422092 TAACCCTTTTAATTAAAATGTGG - Intronic
959273522 3:104245430-104245452 TACCTCTTTCACTTAAAAGGAGG - Intergenic
963082725 3:141409461-141409483 TGAGCCTCTCAGTTAAAATCAGG - Intronic
963586349 3:147194495-147194517 TGAAACTTACAGTTAAAAGCAGG - Intergenic
964874632 3:161352606-161352628 TGACCGATTCAGTTGTAAGGTGG + Intronic
965350078 3:167600431-167600453 TGATCCTTTCAGTTAAAACCAGG + Intronic
966455607 3:180112303-180112325 TGACCTTTACAATTAAAAGTTGG - Intergenic
971495349 4:27258590-27258612 TGACCCTTTCAGTTTTAGGAAGG + Intergenic
972481563 4:39501693-39501715 CGACCCTTTGAGTTAAGTGGTGG - Intronic
973795965 4:54426814-54426836 TGACAATTACAGTTAACAGGTGG - Intergenic
974391538 4:61276396-61276418 TGTTCCTTTAAGTTTAAAGGAGG - Intronic
974594615 4:63999557-63999579 TTCCCCTTTCTGTTAAAATGAGG + Intergenic
976114004 4:81707391-81707413 TGTCCATTTCAGTTTTAAGGAGG + Intronic
976569057 4:86587755-86587777 TCAGCCTTTGAGGTAAAAGGTGG + Intronic
977206106 4:94166816-94166838 TGACCATTTCAGGGAAAAGGTGG - Intergenic
978593987 4:110356862-110356884 TGACATTTTCAATTTAAAGGTGG - Intergenic
981751991 4:148101797-148101819 TGGCTCTTTCTGTTAAATGGTGG - Intronic
982918602 4:161246100-161246122 TCACCCTTTCAGTTTAAAGTAGG - Intergenic
987943292 5:24570424-24570446 TGGCCATTTCAGTTCAAAGAGGG + Intronic
988537591 5:32082859-32082881 TGACTCTGTCTGTTAAATGGTGG + Intronic
990907066 5:60815472-60815494 TAACCCTTTCATTAAAAAGTAGG + Intronic
993130013 5:83884614-83884636 TGACCCTTACATTTCATAGGGGG - Intergenic
993347465 5:86802493-86802515 TGACACTGGCAGTTAACAGGAGG + Intergenic
993603365 5:89956216-89956238 TGACCATTTCAGTCACAAGGAGG + Intergenic
994026753 5:95093376-95093398 AGACCCACTCACTTAAAAGGAGG - Intronic
994163481 5:96583318-96583340 TGACAATTTCTGTTCAAAGGAGG + Intronic
995540876 5:113184980-113185002 TGACCCTTTCAGTTAAAAGGTGG - Intronic
995840869 5:116442029-116442051 TGACCCTTTCATTTTAAAAATGG - Intergenic
996891972 5:128431631-128431653 TCATCTTTTCATTTAAAAGGGGG + Intronic
997365326 5:133321781-133321803 TGACTCTTCCAGAGAAAAGGTGG + Intronic
1004615243 6:17282201-17282223 CTACCTTTGCAGTTAAAAGGCGG - Intronic
1005007097 6:21298481-21298503 TGATCCTTTGAGGGAAAAGGAGG - Intergenic
1008085753 6:47242474-47242496 TGACACTTTGACTTAAATGGGGG - Intronic
1008668412 6:53741459-53741481 AGACACTTGCATTTAAAAGGGGG + Intergenic
1015719000 6:136221739-136221761 TGACTATTTAAGTTAAAAGCAGG - Intergenic
1015826207 6:137314551-137314573 TGAGCCTTTAAGTTAAAGGAAGG - Intergenic
1017009536 6:150053957-150053979 TGACCCTCTGACTTAAATGGTGG + Intergenic
1018690953 6:166343522-166343544 AAAATCTTTCAGTTAAAAGGTGG + Intergenic
1020458689 7:8403474-8403496 TTACCCTTGCAGATAACAGGAGG + Intergenic
1020577993 7:9958433-9958455 TATCCCTTTAATTTAAAAGGGGG + Intergenic
1021037131 7:15813635-15813657 TCTCACTTTCAGTTAAAAGCCGG + Intergenic
1022797814 7:33746129-33746151 TGACTCATTCAGGAAAAAGGAGG - Intergenic
1023786275 7:43711492-43711514 TGATCCATTGAGTCAAAAGGTGG + Intronic
1025233568 7:57218875-57218897 TGACCCTCTGACTTAAATGGTGG - Intergenic
1025233766 7:57220002-57220024 TGACCCTCTGACTTAAATGGCGG - Intergenic
1028188470 7:87817769-87817791 TGAACCTTACAGTTCAGAGGGGG - Intronic
1030764756 7:113395296-113395318 TGACCCTTTCTGCTATAAGCAGG - Intergenic
1030887009 7:114950864-114950886 TGACCCTTTAAGTTTCAATGAGG - Intronic
1031433204 7:121698985-121699007 TGAACCTTTCAAATAATAGGTGG - Intergenic
1031726700 7:125248815-125248837 GGACCTTTTCAGTGAAAAGAAGG - Intergenic
1033473447 7:141668746-141668768 TGACCCTTTTAGAAGAAAGGAGG - Intronic
1035277219 7:157754769-157754791 TGGTCATTTCAGGTAAAAGGTGG + Intronic
1035745946 8:1962204-1962226 TCATCCTTTCAGTTGGAAGGAGG + Intergenic
1039779157 8:40766911-40766933 TCGCCCTTTGAGTTAAGAGGAGG - Intronic
1041646942 8:60262672-60262694 AGACCCTTTCAGGTAACAGGAGG + Intronic
1043909854 8:85851323-85851345 TGAGACTTTGAGTCAAAAGGAGG - Intergenic
1045837678 8:106542109-106542131 TGACCCTTTCTTTTACAAAGAGG + Intronic
1051075430 9:13228233-13228255 TGAACATTTCAGTCTAAAGGGGG + Intronic
1054968091 9:71052892-71052914 TGGCCATTTCAGTCAAAAAGAGG - Intronic
1060696753 9:125715905-125715927 TGAACCTTTCACTTAAAAATTGG + Intergenic
1191568088 X:62566922-62566944 GGACCCTTTCAGTCCTAAGGTGG + Intergenic
1194216006 X:91131107-91131129 AGAGCCTTTCAGTTAGAAGCTGG + Intergenic
1194540695 X:95167876-95167898 CAACCTTTTCAGTTAAAAGACGG - Intergenic
1195438489 X:104873588-104873610 TGACACTTTCAATTCAGAGGAGG + Intronic
1198597662 X:138254556-138254578 TCACCTTTTCACTTAAAGGGAGG + Intergenic