ID: 995552733

View in Genome Browser
Species Human (GRCh38)
Location 5:113296571-113296593
Sequence GGAATGTGCAGAGCGGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995552727_995552733 7 Left 995552727 5:113296541-113296563 CCACTGTGAGAGAAAGTATGGAT 0: 1
1: 1
2: 2
3: 11
4: 239
Right 995552733 5:113296571-113296593 GGAATGTGCAGAGCGGGCATGGG 0: 1
1: 0
2: 0
3: 11
4: 133
995552725_995552733 12 Left 995552725 5:113296536-113296558 CCAGGCCACTGTGAGAGAAAGTA 0: 1
1: 0
2: 1
3: 12
4: 148
Right 995552733 5:113296571-113296593 GGAATGTGCAGAGCGGGCATGGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995552733 Original CRISPR GGAATGTGCAGAGCGGGCAT GGG Intronic
903371367 1:22838164-22838186 TGGATGTCCAGAGAGGGCATGGG - Intronic
903414748 1:23174529-23174551 GGAAGGTGTGGAGGGGGCATAGG - Intronic
906263033 1:44407411-44407433 GGAATGAGCAGAGGGGGGAAAGG + Intronic
908165300 1:61451557-61451579 GGGATGTGCTGAGCGGGAGTGGG - Intronic
910561557 1:88597409-88597431 GAAATCTGGAGAGCAGGCATGGG + Intergenic
911582463 1:99650034-99650056 GGAATGTGAGGAGTGGGGATGGG + Intronic
916107408 1:161441695-161441717 GGAGTCTGGAGAGCGGGCAAGGG - Intergenic
916108993 1:161449113-161449135 GGAGTCTGGAGAGCGGGCAAGGG - Intergenic
916110581 1:161456494-161456516 GGAGTCTGGAGAGCGGGCAAGGG - Intergenic
916112166 1:161463904-161463926 GGAGTCTGGAGAGCGGGCAAGGG - Intergenic
916113753 1:161471285-161471307 GGAGTCTGGAGAGCGGGCAAGGG - Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916509089 1:165455338-165455360 GGAATGTGCAAAGTGTGTATGGG - Intergenic
921197567 1:212774044-212774066 GGTATGTGCGGAGCGGGGAAGGG + Intronic
923344720 1:233040620-233040642 GGAATGACCAGAGAGGCCATAGG - Intronic
924368773 1:243324324-243324346 GGAATGTCAAGAGCAAGCATAGG - Intronic
1065201315 10:23316053-23316075 GGAATGAGCACAGCAGGCCTGGG - Intronic
1068489629 10:57706808-57706830 GGAATGTGGAGAGAGGACAGCGG - Intergenic
1069616000 10:69806448-69806470 GGGTTGTGCAGAGCCGGGATTGG + Intronic
1072224266 10:93353336-93353358 GGAATGTGGGGAGCAGGCAGAGG + Intronic
1072370545 10:94762482-94762504 AGAATGTACAGAGTGGGCACTGG + Intronic
1072386739 10:94938461-94938483 GGAATGTACAGAGTGGACAATGG + Intergenic
1072822328 10:98570171-98570193 GGAATGTTCAGAGCTGGCCTTGG - Intronic
1076287281 10:129312541-129312563 GGAATGTGCAGACTGAGCACTGG - Intergenic
1076358034 10:129867039-129867061 GGACTGTACAGAGAGGGCAGGGG - Intronic
1076573058 10:131445048-131445070 CGCATGTGCAGAGCTGGAATGGG + Intergenic
1080976550 11:37349559-37349581 GAAATCTGGAGAGCAGGCATGGG + Intergenic
1083275747 11:61596030-61596052 CTAATGGGCAGAGCGGGCACTGG + Intergenic
1088176561 11:107059123-107059145 GGAATGTGCAGAGCGACAAATGG + Intergenic
1088264848 11:107979254-107979276 GAAATGTGGAGAACAGGCATGGG + Intergenic
1089396267 11:118137918-118137940 GGAAGGGGCAGAGCAGGCAGTGG + Intronic
1092049901 12:5461049-5461071 GGAGTGTGCAGAGTGGGATTGGG + Intronic
1094038374 12:26095377-26095399 GGAATGTGCTGAGTGAGCATGGG - Intergenic
1096419598 12:51445611-51445633 GGAATGTGCAGAGCTGGTTCTGG - Intronic
1096521564 12:52187440-52187462 CGAAGGTGCAGAGAGGGCAGTGG - Intronic
1096997506 12:55848036-55848058 GGACTGTGCACAGCTGGAATTGG + Intergenic
1097265583 12:57742542-57742564 GGGATGTGTAGAGAGGGCAATGG - Intronic
1103869461 12:124080964-124080986 GAACTGTGCAGACCGGGCCTCGG + Intronic
1104905397 12:132210652-132210674 GGGCTGTGCAGAGCTGGCATGGG + Intronic
1105432742 13:20352054-20352076 GGAAAGAGCAGGGCTGGCATGGG - Intergenic
1106521986 13:30506220-30506242 GGAATGAGCTGAGTGGGCAGGGG + Intronic
1109562729 13:64075088-64075110 GTAAGGTGCAGAGCGGTGATGGG + Intergenic
1118840415 14:69505794-69505816 GGAATGAGCAGAGCGTGCAGGGG + Intronic
1119712115 14:76829815-76829837 GGAATGGGCAGGGAGGGCATGGG + Intronic
1120349947 14:83342567-83342589 GGTATGGGCAGAGTGGGCCTGGG + Intergenic
1121313318 14:92946732-92946754 GTAATGTGCAGTGCTGGCACTGG - Intronic
1123183259 14:106489547-106489569 TGAATGTGCATAGGCGGCATAGG + Intergenic
1202889355 14_KI270722v1_random:141151-141173 TGAATGTGAAGAGAGGACATAGG - Intergenic
1123894858 15:24818537-24818559 TGAATGTGGAGAAAGGGCATTGG - Intergenic
1128240858 15:66100119-66100141 TGAATGGGCAGAGCGTGCACGGG - Intronic
1128325648 15:66722470-66722492 GGGATAGGCAGAGTGGGCATGGG - Intronic
1130316319 15:82800005-82800027 GGAATGTCCAGGGAGGGCAGAGG - Intronic
1135617244 16:23921965-23921987 GGAAAGGGCAGAGCAGGCAGGGG + Intronic
1136296816 16:29308698-29308720 GGCATGAGCTGAGGGGGCATGGG - Intergenic
1141382686 16:83589952-83589974 GAAATGTGCAGGGAGGGCAGAGG + Intronic
1142484271 17:236587-236609 GCAAGCTGCAGAGCGGGCGTCGG + Intronic
1143284401 17:5778490-5778512 GCCATGTGCAGAGCGGGACTGGG + Intronic
1143682516 17:8487928-8487950 GGTAGGCACAGAGCGGGCATGGG + Intronic
1145280170 17:21462301-21462323 GGAACGTGCAGGGTGGTCATTGG + Intergenic
1145752893 17:27367855-27367877 GGCCTGTGCCGAGCGGGCAGTGG - Intergenic
1146610749 17:34302951-34302973 AAAATCTGCAGAGTGGGCATTGG - Intergenic
1149430323 17:56592577-56592599 GAACTGGGCAGAGCGGGCAGCGG + Intergenic
1150486216 17:65545825-65545847 TGAGTGTGCAGAGCAGGCAGGGG - Intronic
1151151851 17:72095227-72095249 GGTGTGTGCACAGTGGGCATGGG - Intergenic
1157509692 18:48261975-48261997 GGAAGGTGCAGAGGGGACAAAGG + Intronic
1160966212 19:1748066-1748088 AGAATCTGCAGACCGGGGATGGG - Intergenic
1162919637 19:13893002-13893024 GGAATGTGCCCAGAGGGCAAGGG - Intronic
1163747290 19:19055977-19055999 GGTAGGTGCAGAGAGGGCATGGG + Intronic
1167312462 19:48745083-48745105 GGAAGTGGCAGAGCAGGCATTGG + Intronic
1167505965 19:49871204-49871226 GGAATGTGCAGGGTGGGGATGGG + Intronic
1168423438 19:56220153-56220175 TGATTGAGCAGACCGGGCATGGG - Exonic
927406397 2:22774290-22774312 GGAATGAGTAGAGCAGGCAGGGG + Intergenic
929140936 2:38666117-38666139 GGAGTTTGAAGAGCGGGCAGTGG + Exonic
930933755 2:56920683-56920705 GGCATGCCCAGAGAGGGCATGGG + Intergenic
931141228 2:59460195-59460217 GGCATTTGCAGAACGGGAATGGG + Intergenic
932798139 2:74715541-74715563 GAAATGTGCAGAGCCGGCCCTGG - Intergenic
935147966 2:100409128-100409150 GGAATGAGCAGAGCAGGCAGTGG - Intronic
938264331 2:129915635-129915657 GGAAAATGCAGAGGGGACATTGG + Intergenic
939075971 2:137602945-137602967 GGGATGTGATGAGTGGGCATGGG - Intronic
940010903 2:149053797-149053819 GAAATGTCCAGAGCAGGCAAAGG - Intronic
946299670 2:218814840-218814862 GGAGTGTGCAGAGCGGGGAGTGG + Intronic
947517286 2:230816950-230816972 TGAGTGTGCAGAGCCGGCAGTGG - Intronic
948875580 2:240825643-240825665 GGTGTGTGCAGAGAGGGCAGTGG - Intergenic
1169283854 20:4290716-4290738 GGCATGTGAAGAGTGGTCATTGG + Intergenic
1172625344 20:36343482-36343504 GGAAGGAGCAGAGCTGGGATGGG + Intronic
1178828423 21:36034738-36034760 CGATTCTGCAGAGCGGCCATCGG - Exonic
1179590546 21:42405228-42405250 GGCATGTGCAGGGCGGCCACCGG + Intronic
1180331484 22:11484840-11484862 TGAATGTGAAGAGAGGACATAGG - Intergenic
1184714426 22:46272901-46272923 GCCATGTGTACAGCGGGCATGGG + Intronic
949445311 3:4128744-4128766 GAAATCTGGAGAACGGGCATGGG + Intronic
950014845 3:9748321-9748343 GGAAGGTGCAGAGCTAGAATTGG + Intergenic
955032308 3:55233128-55233150 AGAATGTGCTGAGCGGGGTTGGG - Intergenic
957091180 3:75731813-75731835 TGAATGTGAAGAGAGGACATAGG + Intronic
961328824 3:126127204-126127226 GGAGTGTGCAGAGCTGGCCCTGG + Intronic
961524261 3:127486621-127486643 GGAATGGGCAGGACGGGCACAGG - Intergenic
961814929 3:129544517-129544539 GGTATGGGCAGTGGGGGCATGGG + Intronic
966445377 3:179996261-179996283 GAAATCTGGAGAGCAGGCATGGG + Intronic
967258751 3:187620844-187620866 GGAATGTGGAGGGAAGGCATGGG + Intergenic
969352624 4:6606493-6606515 GGCATGTACAGAGGGGGCATGGG - Intronic
969677977 4:8625210-8625232 GGAACCCGCAGAGCGGGAATCGG + Intergenic
969678932 4:8630846-8630868 GGAACCCGCAGAGCGGGAATCGG + Intergenic
969679888 4:8636496-8636518 GGAACCCGCAGAGCGGGAATCGG + Intergenic
971420093 4:26466826-26466848 TGAATGTGCAGAGAGATCATGGG - Intergenic
973685825 4:53368711-53368733 GGACTGTGGAGAGGGGGAATGGG - Intergenic
975727848 4:77309303-77309325 GGAATGTGGAGAGTGGGAAGAGG - Intronic
976144920 4:82032888-82032910 GGCCTGGGCAGAGCGGTCATGGG - Intronic
982835207 4:160114267-160114289 GGAACCTGAAGAGCAGGCATGGG + Intergenic
986268214 5:6208781-6208803 AGGATGTGCAGAGGGGACATGGG + Intergenic
986782028 5:11075276-11075298 GGAATGGGGAGAGAAGGCATTGG + Intronic
989411487 5:41124487-41124509 TGAAAGTGCAGAGTGGGGATGGG - Intergenic
995552733 5:113296571-113296593 GGAATGTGCAGAGCGGGCATGGG + Intronic
997578028 5:134997704-134997726 AGAATGTGCAGAGGGAGCAGAGG - Intronic
997669980 5:135662828-135662850 GGAATGTATAGAGGGGGAATTGG - Intergenic
1000014211 5:157263580-157263602 GGAATGTGGAGGGAGGGAATGGG + Intergenic
1006062046 6:31430857-31430879 GAAATGTGGAGAACAGGCATGGG + Intergenic
1006457836 6:34142235-34142257 GGCATGTGGGGAGCTGGCATTGG - Intronic
1013367919 6:109448904-109448926 GGGATGGGCAGAGGGGGCCTTGG - Intronic
1015768118 6:136740236-136740258 GGAGTGTGCACAGCGGGGCTGGG + Intronic
1020710027 7:11595312-11595334 GAAATCTGCAGAACAGGCATGGG + Intronic
1021198366 7:17697828-17697850 GGTATGTGCAGAGTAGGCAGAGG - Intergenic
1024402927 7:48945989-48946011 GGAAAGTGCAGAGCAGAGATGGG + Intergenic
1025987687 7:66469322-66469344 GGAATGAGCAGAGCAAGCAGGGG + Intergenic
1026003977 7:66586212-66586234 GGAATGAGCAGAGCAAGCAGGGG + Intergenic
1026027259 7:66755815-66755837 GGAATGAGCAGAGCAAGCAGGGG - Intronic
1027407109 7:77873359-77873381 GAAATCTGCAGAACAGGCATGGG - Intronic
1027700180 7:81459937-81459959 GGAATGTTCAGAGAGGGAAGAGG - Intergenic
1030063307 7:105640231-105640253 TGAAGGTGCAGAGAGGGCAGGGG + Intronic
1031903874 7:127439883-127439905 GGAATTAGCATAGCAGGCATTGG - Intergenic
1031913856 7:127544444-127544466 GGAGTGTGCAGCACAGGCATGGG - Intergenic
1035520757 8:273775-273797 GGAAGGTGTAGAGGGGGGATGGG + Intergenic
1039920515 8:41891032-41891054 GGAAGGTGCAGAGAGAGCAATGG + Intronic
1042064508 8:64859019-64859041 GGGATGTGTAGATCTGGCATTGG - Intergenic
1048320213 8:133393716-133393738 GGAATGTTCAGAGGGGGGAGGGG + Intergenic
1049389407 8:142360320-142360342 GGCAAGGGCAGAGCGGGCACTGG + Intronic
1052151728 9:25125824-25125846 GAAATCTGGAGAACGGGCATGGG - Intergenic
1052596181 9:30561102-30561124 GGAATGAGGAGAATGGGCATAGG - Intergenic
1053458804 9:38252563-38252585 GGAGTGTGCAGAGGGGACAGAGG - Intergenic
1054929638 9:70622586-70622608 GGAATGTGCAAAACAGGCACAGG + Intronic
1056268675 9:84925126-84925148 GGAAGGTGCAGAGAGGGCAGTGG - Intronic
1061937363 9:133865340-133865362 GGAAAGTGCAGAAGGGGCAGTGG - Intronic
1062548881 9:137077113-137077135 GGAGTGGACAGGGCGGGCATGGG + Intergenic
1203486484 Un_GL000224v1:60551-60573 TGAATGTGAAGAGAGGACATAGG - Intergenic
1203499105 Un_KI270741v1:2450-2472 TGAATGTGAAGAGAGGACATAGG - Intergenic
1193978957 X:88157903-88157925 GGAATCTGGAGAACAGGCATGGG + Intergenic
1194525016 X:94967671-94967693 GCAATGTGCAAAGCAGCCATTGG - Intergenic