ID: 995553927

View in Genome Browser
Species Human (GRCh38)
Location 5:113308475-113308497
Sequence AGGTTTTTAGAGATGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995553927_995553939 27 Left 995553927 5:113308475-113308497 CCCATCCCCATCTCTAAAAACCT 0: 1
1: 0
2: 2
3: 34
4: 304
Right 995553939 5:113308525-113308547 TAAGACTAACACTTTGGGCTAGG 0: 1
1: 0
2: 1
3: 26
4: 240
995553927_995553937 22 Left 995553927 5:113308475-113308497 CCCATCCCCATCTCTAAAAACCT 0: 1
1: 0
2: 2
3: 34
4: 304
Right 995553937 5:113308520-113308542 AGCCATAAGACTAACACTTTGGG 0: 1
1: 0
2: 1
3: 23
4: 559
995553927_995553936 21 Left 995553927 5:113308475-113308497 CCCATCCCCATCTCTAAAAACCT 0: 1
1: 0
2: 2
3: 34
4: 304
Right 995553936 5:113308519-113308541 CAGCCATAAGACTAACACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995553927 Original CRISPR AGGTTTTTAGAGATGGGGAT GGG (reversed) Intronic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
906260018 1:44379919-44379941 ATGTTTTTGGACATGGGGGTGGG - Intergenic
906300110 1:44675341-44675363 AGACTTTTAGAGATAGGGAGGGG + Intronic
908097035 1:60749836-60749858 ATTTGTTTAGAAATGGGGATGGG + Intergenic
908538347 1:65099668-65099690 TGTTTTGTAGAGATGGGGTTTGG - Intergenic
908947290 1:69514465-69514487 TGGTTTTTAAAGATGGTGTTTGG - Intergenic
909802359 1:79826580-79826602 AAGTCTCTAGAGATGGGAATAGG + Intergenic
910880096 1:91915427-91915449 AGTTTTTTTGAGATGGTGTTTGG - Intergenic
911554550 1:99327650-99327672 AGGTTTTTAGAGATGATGTTTGG - Intergenic
911677264 1:100673459-100673481 AGCTTTTTAGACAAGTGGATTGG + Intergenic
912880341 1:113406114-113406136 ATTTTTTTAAAGATGGGGTTTGG - Intronic
915820343 1:159016643-159016665 AGGTCTTGGGAGATGGGGAACGG - Exonic
916313915 1:163426756-163426778 AGGGTTTGAGGGATGGGGACTGG + Intergenic
916754688 1:167757857-167757879 AGGTTTTTAGAGGTTGGGTGAGG + Intronic
918136137 1:181675485-181675507 ATGTGTTAAGAGAAGGGGATGGG + Intronic
918631070 1:186719157-186719179 AGGTTTTTATGGATGGGGAGTGG + Intergenic
919096825 1:193047295-193047317 AGGTTAGTAGAGATGGGTGTGGG + Intronic
920195200 1:204222155-204222177 AGGTGATGAGAGATGGGGAGAGG - Exonic
920573503 1:207036636-207036658 AGGTTTGTAAATTTGGGGATGGG - Intronic
921369563 1:214407634-214407656 AGGTTTTGAGAGACTGGGATAGG - Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
1062765870 10:64439-64461 AGGGTTTTAGAGTTAGGGTTAGG - Intergenic
1064582467 10:16808304-16808326 ATTTTAGTAGAGATGGGGATGGG - Intronic
1064864079 10:19859592-19859614 AGGCTTTAACAAATGGGGATAGG - Intronic
1065593058 10:27285184-27285206 AGGTTTTTCAAGATGATGATGGG - Intergenic
1065657314 10:27965096-27965118 AGGTTTTTCAAGATGATGATGGG + Intronic
1065701703 10:28432129-28432151 AGGTTTTCGGAGATGGGGTATGG - Intergenic
1067544149 10:47179842-47179864 AATTTTGTAGAGATGGGGGTGGG - Intergenic
1068458600 10:57294368-57294390 GAGTTTTAAGAGAAGGGGATTGG - Intergenic
1069179352 10:65337235-65337257 AGGTTTAGAAATATGGGGATAGG + Intergenic
1069501026 10:68953367-68953389 AGGTTCTTTGAGGTGGGGACTGG + Intergenic
1071289213 10:84176542-84176564 AGGTTTGTTGAGTTGGGGCTAGG - Exonic
1071688750 10:87792609-87792631 ATTTTTTTAGAGGTGGGGGTGGG - Intronic
1072576334 10:96704080-96704102 AGGTTTCTAGATGTTGGGATGGG - Intronic
1074506044 10:114071695-114071717 AGGAGTTTAGAGGTGGGGACAGG + Intergenic
1076935680 10:133566589-133566611 AGGGTTTTAGTGTTGGGGTTAGG + Intronic
1076935718 10:133566698-133566720 AGGGTTTTAGGGTAGGGGATAGG + Intronic
1077431321 11:2517284-2517306 AGGTTCCTGGCGATGGGGATGGG + Intronic
1079769114 11:24436291-24436313 AGGTTTTTAGAGAATTGAATTGG - Intergenic
1080613289 11:33923963-33923985 AGGTTATATCAGATGGGGATGGG + Intergenic
1081414621 11:42799683-42799705 AGGTTCTTTGAGAAGGGGAGGGG - Intergenic
1082019995 11:47524433-47524455 AGGTTGTTAGGGATGGGGTGAGG - Intronic
1082953688 11:58846458-58846480 AGGTTGGGAGGGATGGGGATTGG - Intronic
1084134150 11:67162888-67162910 AATTTTTTAGAGATGGGGTCTGG + Intronic
1084144545 11:67257379-67257401 TGGTTTTTAGAGGTGAGGGTTGG + Exonic
1085273725 11:75285125-75285147 AGGTTTTCAGAGCTTGGGCTTGG + Intronic
1086536251 11:87850500-87850522 ATGTTTTGAGAGGTGGTGATGGG + Intergenic
1086551173 11:88054121-88054143 AAGTTCTTAGAGATGTGGCTGGG - Intergenic
1086795694 11:91099057-91099079 AGGTATTTAGAGTTGTGGAAAGG - Intergenic
1087158572 11:94927528-94927550 TGATTTTTAGAGATAGGCATGGG - Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1087956991 11:104300597-104300619 AAGTATTTTGAGATGGGGAAGGG - Intergenic
1090310405 11:125731617-125731639 AGCTTTTCTGGGATGGGGATGGG + Intergenic
1092377498 12:7967975-7967997 AGTTTTTTAAAGATAGAGATTGG + Intergenic
1092498451 12:9022126-9022148 GGTTTTTTAGAGATGGGGTCTGG - Intergenic
1093915653 12:24799754-24799776 ATTTATTTAGAGATGGGGTTTGG - Intergenic
1094200274 12:27787963-27787985 AGTTTCTTAGAGCTGGGCATAGG + Intronic
1095515996 12:43006121-43006143 AGGCTATGAGAGCTGGGGATGGG - Intergenic
1096456084 12:51788266-51788288 AGGTGTTAAGCGATGGGGGTTGG - Intronic
1097692617 12:62747445-62747467 AATTTTTTAGAGATGGGTACCGG + Intronic
1098672247 12:73246761-73246783 AGGTTTGTAGACAGGTGGATAGG - Intergenic
1099366204 12:81767592-81767614 TGGTATTTTGAGTTGGGGATTGG + Intergenic
1101996237 12:109527164-109527186 AGGTCCTTAGACATGGGAATTGG + Intronic
1103200864 12:119086893-119086915 TGGTGTTTAGAGTTGGGGTTTGG - Intronic
1103586245 12:121958471-121958493 AGGGTTTTTGAGAAGGGGCTTGG + Exonic
1103994143 12:124818136-124818158 GGGTTCTAAGAGCTGGGGATGGG + Intronic
1104082113 12:125438253-125438275 AGGTTTTTGGAGATTGGCAACGG + Intronic
1105907934 13:24832711-24832733 AGGGTTTTAGATAGGGGGATTGG + Intronic
1106311044 13:28554581-28554603 ATTTTTTTAGAGATTGGGGTGGG + Intergenic
1109248654 13:59990217-59990239 AGGTTTTTCAGGATGAGGATAGG - Intronic
1109683383 13:65783251-65783273 TGGTTGTTAGAGATGGGAATAGG + Intergenic
1110858111 13:80319140-80319162 AGGTTTTAAAAGACAGGGATGGG - Intergenic
1110993319 13:82071498-82071520 ATGTTTTTAGAGACAGGGAAAGG - Intergenic
1111423058 13:88042867-88042889 ATGTTTTCAGAGCTGGAGATTGG + Intergenic
1112651424 13:101402975-101402997 AGGAGTCTAGAAATGGGGATAGG - Intronic
1112845032 13:103631630-103631652 ATATTTGTAGAAATGGGGATTGG - Intergenic
1113977617 13:114241267-114241289 ATCTTTTTACAGATGAGGATAGG + Intronic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1116201402 14:41802281-41802303 AGGTTGTCAGGGATGGGAATTGG + Intronic
1116543844 14:46136922-46136944 TGGTTTTTTGGGGTGGGGATGGG - Intergenic
1117389229 14:55247356-55247378 TGGTTTTTCCAGATGGGGTTGGG - Intergenic
1117903929 14:60565091-60565113 TTTTTTTTAGAGATGGGGGTTGG - Intergenic
1119343061 14:73897222-73897244 AGGGTTAAAGAGATGGGGAGTGG + Intronic
1120953636 14:90062913-90062935 AGGCTTTTACAGATAGGGACAGG + Intronic
1121157201 14:91697221-91697243 ATGGTTTTAGAGTTGGGGTTGGG + Intronic
1121605691 14:95238209-95238231 AGGTGTTGAAAGATGGGGAAAGG - Intronic
1122152041 14:99730689-99730711 AGGTTTACAGAGAAGGGGACAGG - Intergenic
1122499207 14:102184930-102184952 TGGTCTTTAGTGAAGGGGATGGG + Intronic
1202873593 14_GL000225v1_random:188230-188252 ATTTTTTTAGAGATGGGGGCAGG + Intergenic
1123956617 15:25342595-25342617 AGATTTTTAGAGATGTGAGTAGG - Intronic
1124676646 15:31692893-31692915 GGGTTGTTAGTGGTGGGGATGGG - Intronic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1128438115 15:67675978-67676000 AGGCTTTTAGAGGTGGGGACTGG - Intronic
1129012365 15:72432478-72432500 ATTTTTGTAGAGATGGGGTTTGG + Intergenic
1129040096 15:72678477-72678499 AAGTTTGTAGAGATGGGGTCTGG + Intronic
1130538963 15:84807980-84808002 ATCTTTTTAGAGATGGGGTCTGG + Intergenic
1131706232 15:94999365-94999387 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1132497057 16:268915-268937 CTGGTTTTAGAGATGGGGATGGG + Exonic
1135359165 16:21796749-21796771 TGGTGGTTAGGGATGGGGATGGG + Intergenic
1135457717 16:22613186-22613208 TGGTGGTTAGGGATGGGGATGGG + Intergenic
1136076238 16:27819386-27819408 GGGTTGTCAAAGATGGGGATGGG - Intronic
1136316245 16:29455980-29456002 AGCATCTTAGAGATGGGGATAGG - Intronic
1136430822 16:30195322-30195344 AGCATCTTAGAGATGGGGATAGG - Intronic
1139021499 16:62755604-62755626 ATTTCTTTAGAGATGGAGATTGG + Intergenic
1142143241 16:88481862-88481884 AGGTTTTGAGAAATGGGCAAGGG - Intronic
1142636278 17:1259763-1259785 ATTTTTGTAGAGATGGGGGTGGG - Intergenic
1146638759 17:34524920-34524942 AGGTGTTTGGAGCTGGGGATGGG + Intergenic
1147236776 17:39063753-39063775 AGGTTTTTGGAGACAGAGATTGG + Exonic
1148867644 17:50637172-50637194 AGATGTTTAGAGATTGGGGTGGG - Intronic
1149498938 17:57136634-57136656 AGGTGCTTGGAGATGGGGCTGGG + Intergenic
1150376872 17:64688733-64688755 TTGTTTTTAGAGATGGAGTTTGG - Intergenic
1152360201 17:79829502-79829524 AGTTCTTTAGAGAGGGGGAGAGG + Intergenic
1153599049 18:6761143-6761165 AGCATCTTAGAGATGGGGGTGGG + Intronic
1154004771 18:10517652-10517674 ATGTTTTGAGAGATGGGAAGTGG + Intergenic
1155047831 18:22118592-22118614 TATTTTTTAGAGATGGGGGTCGG - Intergenic
1155971012 18:32083732-32083754 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1157288481 18:46393457-46393479 AGGGCTTTAGAAATGGGGCTGGG + Intronic
1158634927 18:59148102-59148124 AGATCTTTGGAGATGTGGATGGG + Intronic
1158863153 18:61612822-61612844 AGGTCTGTACAGATGGGCATGGG - Intergenic
1159503011 18:69298125-69298147 TAGTTTCTAGAGATGGGGAAGGG - Intergenic
1161237924 19:3207118-3207140 GGGTTTGTAGAGATGGAGACTGG - Intronic
1161284540 19:3462593-3462615 AGGTTGTTAGAGCCTGGGATGGG + Intronic
1161588611 19:5118592-5118614 AGCTTTTTGGAGATGCGGAGGGG - Intronic
1163157433 19:15447157-15447179 AGGTGTTTGGAGATGGGGGTGGG + Intronic
1164944673 19:32283436-32283458 AGGCTTTGAGAAATGGGGAGAGG - Intergenic
1166202410 19:41246730-41246752 ATTTTTTTAGAGATGGGGTCTGG + Intronic
1166800205 19:45451976-45451998 TGTTTTTTAGAGATGGGGTCTGG + Intronic
1167273508 19:48520483-48520505 TTATTTTTAGAGATGGGAATGGG - Intergenic
1167697613 19:51024527-51024549 AGGGGATTAGAGATGGGGATGGG - Intronic
1168557194 19:57353003-57353025 AGGTTTTTAGTTCTGGGGAAGGG + Intronic
925436104 2:3838607-3838629 AGGGTTTTAGGGAGGAGGATGGG + Intronic
925523436 2:4773676-4773698 AGGTTCTTGGAGTTGGGGTTAGG - Intergenic
925940934 2:8817494-8817516 ATGTTTTTAGAATTTGGGATTGG - Intronic
926226028 2:10967482-10967504 AGGTTTTTGGAGGTGGGGGCAGG + Intergenic
926690909 2:15732733-15732755 AGGGTTCTAGAGATGGGGTGGGG + Intronic
927518715 2:23686776-23686798 AGGTTTGTAGAGATGGGGCTGGG + Intronic
927739860 2:25559196-25559218 GGGTTTTGAGAGTTGAGGATTGG - Intronic
929077518 2:38090739-38090761 AGGTTCATAGAGATGGGAATTGG - Intronic
929864928 2:45709730-45709752 AGGTGAATAGAGATGGGGACTGG - Intronic
930010703 2:46936302-46936324 AAGTTTTTAGAGAAGAAGATAGG + Intronic
930085157 2:47491560-47491582 ATTTTTTTAGAGACGGGGGTGGG - Intronic
935191580 2:100782511-100782533 AGGTTGTAAGAGATGGGGGTGGG + Intergenic
935703106 2:105830233-105830255 AGGTTACTAGAGGTGGGGAAGGG - Intronic
935936152 2:108185239-108185261 AGGTATTAAGAGAAGGGGTTAGG - Intergenic
936451094 2:112634606-112634628 AGCATTTGGGAGATGGGGATAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937378817 2:121357046-121357068 GGGTTTTTAGAGATGGATACCGG - Intronic
938402297 2:131003987-131004009 TGGTTGGGAGAGATGGGGATAGG + Intronic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
942893522 2:181020899-181020921 AAGTTTTTAGAGTTAGGGAATGG + Intronic
942973473 2:181985613-181985635 AAGTTTTTAGAGTTGGGGGCAGG - Intronic
943572178 2:189586503-189586525 AGGTTTTTAGTGATAGGGGTTGG + Intergenic
943582719 2:189703350-189703372 AGATTTTTAGACTTGGTGATGGG + Intronic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946030373 2:216699080-216699102 AGGTGTTTAACAATGGGGATGGG + Intergenic
946241663 2:218359677-218359699 TGGTTTTAAAAGATGGGGGTGGG - Intronic
946332678 2:219019197-219019219 AGGGGTTCAGAGATGGGGATGGG + Intronic
948882215 2:240865207-240865229 GGGTCTTGAGAAATGGGGATTGG - Intergenic
1170614795 20:17939856-17939878 AGGTTTCTAGAAATGGGAATGGG - Intergenic
1171358151 20:24566688-24566710 GAGTTTTCAGAGATGGGGACGGG - Intronic
1172367679 20:34362588-34362610 TTCTTTGTAGAGATGGGGATGGG - Intergenic
1173322846 20:42004645-42004667 AGGTTTTTAGAGAATGGGATGGG + Intergenic
1174000235 20:47369240-47369262 AGGGTTTTAGAGGTGGGGGTTGG - Intergenic
1175157639 20:56982682-56982704 AGGTTCTTACTGATGGGGAATGG + Intergenic
1178345462 21:31822764-31822786 AGGTTATGGGAGATGGGAATTGG + Intergenic
1178881826 21:36456035-36456057 AGGTGGGAAGAGATGGGGATGGG - Intergenic
1179051881 21:37895507-37895529 AGGTAGCTAGAAATGGGGATGGG - Intronic
1182187102 22:28416468-28416490 AGTTCTTTAGGGATGGAGATGGG - Intronic
1183486650 22:38090832-38090854 AGGTTTTTAGTCATGGGGCCAGG - Intronic
1185083686 22:48724338-48724360 AGGTTTCAAGAGAGGAGGATTGG + Intronic
949113794 3:295153-295175 AGTTTTTTTGGGAGGGGGATTGG - Intronic
949587957 3:5461470-5461492 ATGCTTTTAGAGATGGGGGTGGG - Intergenic
950295909 3:11830369-11830391 CGGGTTTTAGAGATAGGTATGGG + Intronic
951314745 3:21176340-21176362 AGGTTTTTATTGATGGGAATTGG + Intergenic
951645942 3:24891550-24891572 ATATTTATAGAGATGGGGGTGGG - Intergenic
951842247 3:27046968-27046990 AGGTTTTTAAAGAGAGGGTTTGG - Intergenic
952923138 3:38300988-38301010 GTTTTTTTAGAGATGGGGGTTGG + Intronic
953899728 3:46833321-46833343 GGGTTTTTGGTGATGGCGATGGG - Intronic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
955671861 3:61410763-61410785 ATGTTTTTAGAGACGGGGGGGGG - Intergenic
956089356 3:65649202-65649224 ATTTTTTTAGAGATTGGGGTGGG - Intronic
956258447 3:67309830-67309852 AGGTTTTTTTAGTGGGGGATGGG - Intergenic
956351843 3:68345807-68345829 ATATTTTTTGAGATGGGGATAGG + Intronic
956534189 3:70257225-70257247 AGGTTTTAAGGAATGGGGAAGGG - Intergenic
956810753 3:72861990-72862012 AGGTTCTAAGAGTTGAGGATGGG - Intergenic
959827995 3:110823386-110823408 AGGTTTTGAGGGCTGGGGAACGG + Intergenic
960153436 3:114274381-114274403 AGCTTCTTGGAGCTGGGGATGGG + Intergenic
960336637 3:116425794-116425816 ATGTTTTTTGAGAGGAGGATGGG + Intronic
962109926 3:132433900-132433922 AGGTTTTTAAAGACGGGGACTGG - Intronic
962503944 3:136027151-136027173 GGGTTTCTAGAGAAGGGGAGGGG - Intronic
963793993 3:149613168-149613190 AGGTTTTAAGAGGTGGGTGTTGG - Intronic
964020187 3:152000705-152000727 TGTTTTATAAAGATGGGGATAGG + Intergenic
964020418 3:152003663-152003685 TGTTTTATAAAGATGGGGATAGG - Intergenic
964885695 3:161479737-161479759 TGTCTTTTAGAGATGGGGAAAGG - Intergenic
965002377 3:162971048-162971070 AGCTATTTAGACATGTGGATTGG - Intergenic
965535748 3:169822321-169822343 AGGTTTTTAAAGATGACGACGGG - Exonic
966444879 3:179990951-179990973 AGTTGTTTATACATGGGGATAGG - Intronic
966606769 3:181828817-181828839 ATGTTTTTAGAAATGGGGTCTGG + Intergenic
968529462 4:1083099-1083121 AGGTATGTAGAGAGTGGGATTGG + Intronic
969618499 4:8267288-8267310 AGGTGTTCAGGGTTGGGGATGGG + Intergenic
971469984 4:27013242-27013264 AGGTATTTCGAGGTGGGGGTGGG + Intronic
971536570 4:27759448-27759470 AGGTTATTAGCTAAGGGGATAGG + Intergenic
973121681 4:46528391-46528413 AGGTTTTTAGTTATGGGGTTTGG + Intergenic
974776504 4:66490004-66490026 ATGTTTTTATAGTTGGGGAAGGG + Intergenic
975174363 4:71270488-71270510 AAGTTGTTAGTGAAGGGGATGGG + Intronic
975561196 4:75709697-75709719 CGGGTTTCAGAGATGGGGTTAGG + Intronic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
976275546 4:83273821-83273843 GTTTGTTTAGAGATGGGGATGGG - Intronic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
978065182 4:104389839-104389861 AGGTTTTTAGAGAAAGGATTGGG + Intergenic
978304044 4:107302722-107302744 AATTTTGTAGAGATGGGGTTTGG - Intergenic
978732120 4:112039929-112039951 AGCTTTTTAGGGTTGGGGATGGG - Intergenic
980598732 4:134990881-134990903 TGATTTTTAGATATGGGGTTTGG - Intergenic
982325861 4:154127578-154127600 AGGTTTCTAGGCTTGGGGATGGG + Intergenic
983681023 4:170353686-170353708 AGGTTGTTATAGATAGGGTTGGG + Intergenic
984760339 4:183357652-183357674 AGGTGAGGAGAGATGGGGATGGG + Intergenic
984850417 4:184147621-184147643 CGTTTTGTAGAGATGGGCATGGG - Intronic
986299678 5:6468100-6468122 AGGTTTATAGAGACGGTGAAAGG - Intronic
987378636 5:17262301-17262323 AGCTTTCTACAGATGAGGATGGG - Intronic
987507772 5:18795325-18795347 AGGTTTTTAGAAATGGGAAGAGG - Intergenic
988798406 5:34673859-34673881 GGGTTTTTAGAGTTGGGGGAGGG - Intronic
990490761 5:56300725-56300747 AGGTTCTTAGAAATTGGGACAGG - Intergenic
990992942 5:61702864-61702886 AGATTTTTAGAGAAAGGGAAAGG + Intronic
992472340 5:77070388-77070410 AGATTTTTACATATGGGGACCGG - Intergenic
993942562 5:94077742-94077764 AGGTTTTTACTGATGTGAATTGG + Intronic
994479147 5:100310964-100310986 AGGTTTTAACAGATGTGGAGAGG + Intergenic
995083220 5:108078302-108078324 AGGTTGTTAGAGATGGACAAAGG - Intronic
995197851 5:109393620-109393642 ATTTTTTTAGAGATGGGGTCTGG - Intronic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
998257860 5:140602584-140602606 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
998286617 5:140869109-140869131 TGGTTTTCAGAGAAGGGGATTGG + Exonic
998819674 5:146047427-146047449 AGGTTTTCATAGAGGGAGATGGG + Intronic
999523092 5:152372877-152372899 AGGTTATCAGATATGGGGACAGG - Intergenic
1001048437 5:168394264-168394286 AGGTTGTGAGTTATGGGGATAGG + Intronic
1001322597 5:170695141-170695163 TGGGTGTTAGAGAAGGGGATCGG - Intronic
1001969877 5:175947033-175947055 AGCTTGTGAGAGATGGGGCTGGG - Intronic
1002016327 5:176326185-176326207 GGGAGTTTAGGGATGGGGATGGG - Intronic
1002247561 5:177896735-177896757 AGCTTGTGAGAGATGGGGCTGGG + Intergenic
1002297396 5:178239192-178239214 AAGGTTTCAGTGATGGGGATGGG + Intronic
1003287160 6:4744646-4744668 AGGTTTTTAGAGATTAGTAAAGG - Intronic
1003527491 6:6910170-6910192 AGGTCTTTAAAGATGGCTATGGG - Intergenic
1004009642 6:11669949-11669971 TATTTTTAAGAGATGGGGATGGG + Intergenic
1005354855 6:24972548-24972570 AGGTTTTCAGATATGTGGGTAGG + Intronic
1005360698 6:25028280-25028302 ATGTTTTGAGATTTGGGGATAGG + Intronic
1006680003 6:35790102-35790124 ATTTTTGTAGAGATGGGGAGGGG + Intronic
1007320033 6:41021455-41021477 GTGCTTTTAGAGAAGGGGATGGG + Intergenic
1007674612 6:43582704-43582726 GGGTGGGTAGAGATGGGGATTGG + Intronic
1009405725 6:63310087-63310109 AGTTTTGTACAGATGGAGATAGG - Intronic
1009537806 6:64912128-64912150 AGTTAGTTAGAGATGGGCATAGG - Intronic
1009898826 6:69785997-69786019 AGTGTTTTGGAGAGGGGGATAGG - Intronic
1010123977 6:72411713-72411735 TTTTTTTTAGAGATGGGGGTCGG + Intergenic
1010764101 6:79758868-79758890 AGGTTCTAAGGGGTGGGGATGGG - Intergenic
1011152115 6:84286174-84286196 AGGTTTGTAAATCTGGGGATGGG + Intergenic
1011196332 6:84783303-84783325 AGGTGGTCAGAGATGTGGATTGG + Intergenic
1012323583 6:97884615-97884637 ATTTTTTTAGACCTGGGGATGGG + Intergenic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015505590 6:133983458-133983480 AAGTTTGTAGAAGTGGGGATAGG + Intronic
1015792989 6:136982541-136982563 TTTTTTGTAGAGATGGGGATGGG - Intergenic
1015917300 6:138230251-138230273 AGGGTTTTGAAGATGGGGAGGGG - Intronic
1018412110 6:163560483-163560505 AAGTTTGTGGGGATGGGGATAGG + Intronic
1019899615 7:4009922-4009944 AGGTTTTTGGAGAAGCGGCTGGG + Intronic
1021482251 7:21130561-21130583 AGATTTTTTAAGATGGGGACTGG + Intergenic
1021711479 7:23420286-23420308 ATTTTTGTAGAGATGGGGTTTGG - Intronic
1021907370 7:25348677-25348699 AGGTTTTCAGAGTTGGGGGCAGG + Intergenic
1024053612 7:45645794-45645816 AGGTCCTTAGAGTTGGGGATTGG + Intronic
1024572420 7:50734294-50734316 GAGTGTTTAGAGATGGGGCTAGG - Intronic
1025080260 7:55975539-55975561 TGGTTGCTAGAGATGGGGAGAGG + Intronic
1028661659 7:93284086-93284108 ATTTTTTTAGGGAGGGGGATTGG + Intronic
1029598903 7:101552435-101552457 ATTTTTATAGAGATGGGGGTGGG - Intronic
1030549650 7:110942435-110942457 AGGTTTTTAGGAAAGGGGACTGG - Intronic
1030727833 7:112946902-112946924 TGGTTACTAGAGGTGGGGATTGG - Intergenic
1032083985 7:128874191-128874213 AGGGTTTTAGAGACAGGGCTGGG - Intronic
1032219595 7:129983971-129983993 ATCTTTCTAGAGATGGGGTTTGG - Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032803134 7:135332515-135332537 ATGTTTTTAGAGACAGGGACTGG - Intergenic
1033167885 7:139057176-139057198 ATGTTTCTAGAGATGGGGAGGGG - Intronic
1033360160 7:140633339-140633361 ATTTTTATAGAGATGGGGTTTGG + Intronic
1033561072 7:142531459-142531481 AGTTTTGTTGAGATGGGGAAAGG + Intergenic
1034464934 7:151221757-151221779 AGGTGCTTAGGGATGAGGATGGG - Intronic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034787493 7:153938266-153938288 AGCTTTTCAGATCTGGGGATTGG + Intronic
1035149410 7:156855376-156855398 TGGTGTTAAGAGATGGGGAGAGG - Intronic
1037441914 8:18925207-18925229 TGTTTTGTAGAGATGGGGTTTGG - Intronic
1037601193 8:20395488-20395510 AGGTTAATAGACTTGGGGATTGG + Intergenic
1037645365 8:20787888-20787910 AGGCATTTAAAGATGGGGAAGGG + Intergenic
1037855637 8:22368834-22368856 AGGTTTTAAGAGGTAAGGATAGG - Intronic
1038475941 8:27868193-27868215 AGCTTTTTGGAGCTGGGGGTGGG - Intergenic
1039856891 8:41422766-41422788 AGGGTTTTAGAGATGTGCAGTGG - Intergenic
1040383263 8:46893492-46893514 ACATTTCTGGAGATGGGGATGGG - Intergenic
1040679349 8:49789882-49789904 AGGAATCAAGAGATGGGGATGGG + Intergenic
1042020920 8:64370831-64370853 AGGTTCTTAAGGCTGGGGATGGG + Intergenic
1042145025 8:65719234-65719256 AGGTTTTTAGAAATGTGAAATGG - Exonic
1042255018 8:66793920-66793942 AGGTATGTGGAGATGGGGAAGGG - Intronic
1043149676 8:76699219-76699241 ACATTTTTAGAGGTGGGGGTTGG - Intronic
1043341534 8:79245831-79245853 AGATTTTAAGAGCTGGGGATAGG - Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044252580 8:90021443-90021465 ATGTCATTAGAGATGGGGAAAGG + Intronic
1044300539 8:90578086-90578108 GCTTTTTTAGAGATGGGGACAGG - Intergenic
1045038843 8:98201394-98201416 ATTTTTTTAGAGATGGGGTCCGG + Intronic
1046100312 8:109606479-109606501 TGGTTTTTAGAGGTGGGCAGGGG + Intronic
1046237880 8:111450607-111450629 ATGTTTTATGAAATGGGGATGGG - Intergenic
1046599833 8:116303181-116303203 ACATTTTTAGAGATGGGCATCGG + Intergenic
1046863939 8:119125148-119125170 TGGTTTTCAGAGATAAGGATTGG - Intergenic
1047037074 8:120951939-120951961 AGATTTTTAGAGTTGTGGCTGGG + Intergenic
1047710670 8:127548965-127548987 AGGGTTATAGAGATGGGGGAAGG - Intergenic
1050173502 9:2846569-2846591 ATTTTTGTAGAGATGGGGTTTGG - Intergenic
1050265271 9:3883066-3883088 AGGGTATGTGAGATGGGGATTGG - Intronic
1050360916 9:4830273-4830295 AGGTTTTAAGAGCTGAGGTTGGG + Intronic
1050364975 9:4865556-4865578 AGCTTTTCAGAGATTTGGATAGG + Intronic
1052578920 9:30328923-30328945 AGCTTTTGAGAGAAGGGGCTTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054840441 9:69732483-69732505 AGTATTTTGGAGATGGGGAGGGG + Intronic
1055046927 9:71936079-71936101 AGATTTTTAAAGATGAGGTTTGG + Intronic
1055729621 9:79267095-79267117 AGGCTATTTGGGATGGGGATTGG + Intergenic
1056084421 9:83131326-83131348 AGGTTGTTAGAGAAGAGGAGGGG + Intergenic
1056920972 9:90789017-90789039 GGGTTTTTATTGATGGGGTTGGG - Intergenic
1057153735 9:92820235-92820257 AGGTTTTTAGTGTTGGGGAAAGG - Intergenic
1061129572 9:128701263-128701285 AGGTTCTTTGACATGGGGGTTGG - Intergenic
1062739376 9:138159828-138159850 AGGGTTTTAGAGTTAGGGTTAGG + Intergenic
1203730863 Un_GL000216v2:88307-88329 ATTTTTTTAGAGATGGGGGCAGG - Intergenic
1186117535 X:6320841-6320863 AGCTATTTATGGATGGGGATGGG - Intergenic
1186385989 X:9110605-9110627 AGGTTTTTGGATATGGAAATAGG - Intronic
1186796147 X:13048213-13048235 TGGTTTTTATAGCTGGGGATGGG + Intergenic
1186955160 X:14673623-14673645 AGGTTTATAGTGATGGGTAGAGG - Intronic
1187056843 X:15748727-15748749 TTTTTTTTAGAGATGGGGGTTGG - Intronic
1188950150 X:36361220-36361242 AGGTATTTAGAGAAAGGGAGGGG - Intronic
1189114848 X:38331757-38331779 ATTTTTGTAGAGATGGGGTTTGG + Intronic
1189897388 X:45669624-45669646 AGGATTGTAGAGTTGGGGAAGGG + Intergenic
1190299388 X:49047727-49047749 GGGTTTTTAGAGATAGAGTTCGG + Intergenic
1190487155 X:50939207-50939229 AGATTTTTAAAAATGGGGCTGGG + Intergenic
1193460291 X:81783271-81783293 AGGCTTTTAAAGCTGGGGTTTGG + Intergenic
1194417788 X:93635213-93635235 TGTTTTCTAAAGATGGGGATGGG + Intergenic
1195162586 X:102185147-102185169 AGTTTATTAGTGAAGGGGATTGG - Intergenic
1196610878 X:117713353-117713375 AGGTTTTGAGAGGCAGGGATAGG - Intergenic
1197918851 X:131567118-131567140 TGGTTACTAGAGATGGGGAAAGG - Intergenic
1199819681 X:151432442-151432464 AGGTTGTTAAAGATGGGAATTGG - Intergenic
1199969991 X:152852675-152852697 AGGTTTGTGGAGATGGTGCTTGG - Intronic