ID: 995554704

View in Genome Browser
Species Human (GRCh38)
Location 5:113315487-113315509
Sequence ATTCAAACGACTTTCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995554704_995554705 10 Left 995554704 5:113315487-113315509 CCAACATAGAAAGTCGTTTGAAT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 995554705 5:113315520-113315542 AATTTCAGCAGCATCCAAAAAGG 0: 1
1: 0
2: 1
3: 34
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995554704 Original CRISPR ATTCAAACGACTTTCTATGT TGG (reversed) Intronic
908034450 1:60037050-60037072 CTGCAAATAACTTTCTATGTTGG + Intronic
909221639 1:72969952-72969974 ATTCAGACAATTTTATATGTTGG - Intergenic
911598864 1:99826232-99826254 ATTCAAACAATATTTTATGTTGG - Intergenic
914939508 1:152010345-152010367 ATTCTAAGGACTTTCTTTGGGGG + Intergenic
917183900 1:172330237-172330259 ATTCAACCAATTTTCTATGATGG - Intronic
921444652 1:215231201-215231223 ATTTAAAATACTTTCTATGCAGG + Intronic
1063061162 10:2554232-2554254 ATTCAAATGACTTTCCGTTTTGG - Intergenic
1068039416 10:51804279-51804301 TTACAAAATACTTTCTATGTGGG + Intronic
1071141903 10:82519377-82519399 ATTCAAATGACTTTTAAGGTTGG - Intronic
1075692527 10:124407950-124407972 ATTCAAACCACAGTCTATGTAGG + Intronic
1078795743 11:14590855-14590877 CCTCAAACGACTTTATATGGCGG + Intronic
1087019927 11:93591827-93591849 ATTCGAACTACTTTCCATGGTGG - Intergenic
1087143415 11:94788983-94789005 ATTCAAAAGACCTGCCATGTAGG + Intronic
1087906863 11:103708566-103708588 TTTCAAACAAAATTCTATGTTGG + Intergenic
1088029443 11:105228381-105228403 ACTCAAAGAACTTTCTATGGAGG + Intergenic
1088059129 11:105624324-105624346 ATACAAACCACTTTCAAAGTAGG + Intronic
1090944344 11:131416258-131416280 TTCCAAACCCCTTTCTATGTTGG + Intronic
1091942362 12:4499485-4499507 CTTCTAACCAGTTTCTATGTGGG + Intronic
1092025586 12:5236917-5236939 ATTCATAAGACTTTCTACATAGG - Intergenic
1093523163 12:20073676-20073698 CTTGAAACCACTTGCTATGTGGG - Intergenic
1094718698 12:33039062-33039084 AGTGAAACTATTTTCTATGTGGG - Intergenic
1095475485 12:42583218-42583240 ATTAAAACCTTTTTCTATGTTGG - Intronic
1095652029 12:44622623-44622645 ATTGGAAAGACTGTCTATGTTGG - Intronic
1096166419 12:49429197-49429219 ATTTAAAAGACATTCTAAGTGGG - Intronic
1097382856 12:58916342-58916364 ATTAAAACTACATTATATGTAGG + Intronic
1098509837 12:71298909-71298931 CTTCAAACCACTTTCTAATTAGG - Intronic
1108386334 13:49902477-49902499 ATTCAAATGACTTTATAAGATGG - Intergenic
1109331542 13:60936955-60936977 TTTCAAAAGCCTTTCTATGTTGG + Intergenic
1110952220 13:81510069-81510091 ATTGAAATGGCTTTCTCTGTGGG - Intergenic
1111611246 13:90610655-90610677 ATACATACCACTTTCTATATGGG + Intergenic
1113279824 13:108777288-108777310 ATTCAAACTACCTTCTTTGGTGG - Intronic
1117497744 14:56322481-56322503 ATTCAAACGAGCTTCTTTCTTGG - Intergenic
1119353138 14:73982793-73982815 ATTTAAAGTACTTTCTATCTAGG - Intronic
1126772883 15:52075288-52075310 TTTCAAGCATCTTTCTATGTTGG + Intergenic
1128243384 15:66116651-66116673 ATGCAAAGGACTTTGTGTGTTGG + Intronic
1135740957 16:24974808-24974830 AATCAAAGGACTTTCTAATTAGG + Intronic
1142754555 17:2008365-2008387 TCTCAAACACCTTTCTATGTTGG - Intronic
1146427448 17:32755408-32755430 AGTTCAACGACTTTATATGTTGG - Intronic
1147713405 17:42486821-42486843 AGAGCAACGACTTTCTATGTGGG - Intronic
1159245719 18:65802118-65802140 ATTCAAAAGAGTTTTCATGTAGG + Intronic
1159306430 18:66649195-66649217 ATTTAAACCTCTTTTTATGTAGG - Intergenic
1160552799 18:79705738-79705760 ATTCAAAGGTCTTTCTAGATTGG + Intronic
1164616810 19:29672152-29672174 ATTCAATCGTTTTTCTTTGTGGG - Intronic
926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG + Intergenic
926965748 2:18408765-18408787 ACTCAAATGATTTTCAATGTGGG + Intergenic
928019964 2:27696575-27696597 ATTCAAACAAAATTGTATGTGGG + Intergenic
933139390 2:78775457-78775479 AGGCAAACCACTTTCTATCTGGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
944947678 2:204708838-204708860 ATACAAATGACTGTCTATGTAGG - Intronic
945029899 2:205653525-205653547 ATACAAAAGACTTTCTCTGATGG + Intergenic
947070024 2:226278574-226278596 ATTCAAAATGCTTTCTATTTGGG - Intergenic
1169925275 20:10777466-10777488 ATTCCATTGACTTTCTCTGTAGG + Intergenic
1170073506 20:12394645-12394667 GTTCAACTGACTTTCTCTGTGGG + Intergenic
1171197738 20:23214318-23214340 ATTCACATGACTTTCTCTGAAGG + Intergenic
1174667148 20:52270181-52270203 CTTCAAATGACTTTTTTTGTGGG + Intergenic
1176725517 21:10428825-10428847 ATTTTAAGGACTTTCAATGTTGG + Intergenic
1177413867 21:20769618-20769640 ATTAAAACTACTTTCTACTTAGG + Intergenic
1178625761 21:34217208-34217230 AATAAAACTACTTTGTATGTGGG + Intergenic
1181814223 22:25425054-25425076 ATTCAGACGACTTTTACTGTAGG + Intergenic
1181832086 22:25568269-25568291 ATTCAGACGACTTTTACTGTAGG + Intronic
949668707 3:6373014-6373036 ATTCAAATCACTTTCGATTTAGG - Intergenic
951598274 3:24342181-24342203 TTTTAAACCATTTTCTATGTAGG - Intronic
955949416 3:64227025-64227047 CTTCAAATGAATTTCTTTGTTGG + Intronic
960601634 3:119464434-119464456 ATACAAACAACTTTCTATTAAGG - Intronic
968225896 3:196971800-196971822 ATTCAAAAAACTTTCTAGGAAGG - Intergenic
972523066 4:39879931-39879953 ATTCAAAGGAGTTTCTGTGGGGG + Intronic
972702712 4:41509458-41509480 ATTTGATAGACTTTCTATGTAGG + Intronic
974638375 4:64595530-64595552 ATCCAAATAACTTTTTATGTTGG + Intergenic
978317104 4:107450396-107450418 TTTGAAACCACTTACTATGTGGG + Intergenic
983441059 4:167785350-167785372 AAGCAAACTACATTCTATGTTGG + Intergenic
983793846 4:171834503-171834525 CTTCAAATGCCTTTCTTTGTAGG + Intronic
987976465 5:25021052-25021074 CTTAAAGCCACTTTCTATGTGGG - Intergenic
988824282 5:34918869-34918891 ATTCAAAGCACTTTTTAAGTTGG + Intronic
991318165 5:65336098-65336120 ATACAAACTATTTTCTAAGTTGG - Intronic
992105365 5:73446192-73446214 CTTAAAAAAACTTTCTATGTGGG - Intronic
993236358 5:85315034-85315056 ATTCAAATATCTTTGTATGTAGG - Intergenic
995196128 5:109370672-109370694 TTTAAAACTACTTTCTGTGTTGG - Intronic
995554704 5:113315487-113315509 ATTCAAACGACTTTCTATGTTGG - Intronic
996373080 5:122774007-122774029 TTTCAAACCACTTTTAATGTGGG + Intergenic
1000502640 5:162070338-162070360 ATTCAAATGACTTTTTTTATGGG - Intronic
1001317889 5:170657294-170657316 ATTCAAAAGACTTACTGAGTTGG - Intronic
1008825804 6:55692247-55692269 ATTCAAACAAGTGTCTATTTCGG + Intergenic
1013073149 6:106747309-106747331 ATTGAAATGAGTTTCTATGATGG + Intergenic
1014984808 6:127991391-127991413 ATTCAAATTAATTTCTTTGTAGG - Exonic
1017208833 6:151833107-151833129 ACTCACACTCCTTTCTATGTTGG - Intronic
1018585382 6:165351508-165351530 ATTCAAATTACTTGCTATTTTGG + Intronic
1021517010 7:21500536-21500558 ATTCAAACGACTTTGGAAGCAGG - Intronic
1021591311 7:22266002-22266024 ATTCATATTACTTTCTTTGTTGG - Intronic
1022731775 7:33033103-33033125 ATTCAAACTAATTTTTATGTGGG - Intronic
1023525309 7:41096392-41096414 ATTCAAAAGAGTGTCTATGTAGG - Intergenic
1027805405 7:82815429-82815451 ATTCAAATGTCTTTCTATATAGG - Intronic
1028434845 7:90791264-90791286 ATACAAAAGCCTTTCTATGCAGG - Intronic
1029953452 7:104611749-104611771 ATTTACACAAGTTTCTATGTAGG + Intronic
1032847404 7:135763289-135763311 ACTCATATGACTTTCTATCTGGG + Intergenic
1032998294 7:137474111-137474133 ATTCAAATGACTTTTAACGTAGG - Intronic
1034332062 7:150291606-150291628 TTTCAAACAACTTTCTTAGTGGG + Intronic
1034612361 7:152382751-152382773 ATTTTAAAGACTTTCAATGTTGG - Intronic
1034665973 7:152818267-152818289 TTTCAAACAACTTTCTTAGTGGG - Intronic
1036392367 8:8334784-8334806 ATTCAAAGCACTTTCCATGCCGG + Intronic
1037213534 8:16421120-16421142 ATACAAATGACTTTGTATCTGGG + Intronic
1043125286 8:76386394-76386416 AGTCAAGCAACTTTCAATGTGGG - Intergenic
1045901417 8:107285631-107285653 ATTCAAAATAGTTTCTTTGTAGG + Intronic
1046678188 8:117136219-117136241 CTTAAAACTATTTTCTATGTAGG - Intronic
1048524615 8:135190677-135190699 ATTCTAAGGACATTCTCTGTTGG + Intergenic
1185654742 X:1675656-1675678 ATTTTAAGGAATTTCTATGTAGG - Intergenic
1189728913 X:43998085-43998107 ATTGAAAAGACTTTCTATAATGG - Intergenic
1191616921 X:63179347-63179369 ATTTAAACGATTATGTATGTTGG + Intergenic
1191619376 X:63199576-63199598 ATTTAAACGATTATGTATGTTGG - Intergenic
1192040149 X:67611612-67611634 CTTCAAAGGTCTTTCTAGGTGGG + Intronic