ID: 995562199

View in Genome Browser
Species Human (GRCh38)
Location 5:113394710-113394732
Sequence AAGAGCTATCAAATTAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995562199 Original CRISPR AAGAGCTATCAAATTAGACT GGG (reversed) Intronic
901956555 1:12789878-12789900 ATGAATTATCAAATTAGAGTAGG + Intergenic
901979937 1:13026022-13026044 ATGAATTATCAAATTAGAGTAGG + Intronic
902002150 1:13202909-13202931 ATGAATTATCAAATTAGAGTAGG - Intergenic
902021377 1:13348649-13348671 ATGAATTATCAAATTAGAGTAGG - Intergenic
906855603 1:49301185-49301207 AGGAGCTATCAAATGATTCTGGG + Intronic
907340099 1:53728908-53728930 AAGATCTGTGAAATTATACTTGG - Intronic
907736287 1:57115849-57115871 AAGAGATCTGAAGTTAGACTGGG + Intronic
909170555 1:72287765-72287787 AAGAGCTCTGAAAGTAGAGTAGG - Intergenic
909323137 1:74315856-74315878 AGGAGATATAAAAATAGACTAGG + Intronic
911233824 1:95388126-95388148 AAGAGATGTCAAATTTAACTGGG - Intergenic
912581097 1:110721645-110721667 AAGAGCTATGAAAATGAACTGGG + Intergenic
914744808 1:150493859-150493881 AAAAGCTCTGAACTTAGACTGGG + Intronic
915422786 1:155798192-155798214 AAGAATTATCAAGTTAGATTAGG - Intronic
916179643 1:162072235-162072257 AAGATGTATCAAATTAAAATTGG - Intronic
917408185 1:174731429-174731451 AAAAGTTATCAAAGTACACTGGG - Intronic
919770917 1:201158012-201158034 AGGAGCCATCTAATTAGATTGGG - Intronic
920116941 1:203628164-203628186 AAGAGCTAGGAATTAAGACTGGG + Intronic
921343357 1:214156324-214156346 AACAGCAATCAAATTATGCTAGG - Intergenic
1063361434 10:5462746-5462768 CAGATCTATCAAGTTAGACCTGG + Intergenic
1063474131 10:6313806-6313828 AATAGCTATTAAATTAGGCTTGG + Intergenic
1064625124 10:17253664-17253686 AAGAGCTATCACAGTAGAAAAGG - Intergenic
1065618173 10:27550338-27550360 AAGAGTCAGCAAATGAGACTGGG + Intergenic
1066082075 10:31941136-31941158 AAAATCAATCAAAATAGACTTGG - Intergenic
1066639031 10:37537097-37537119 AAATGCTATTAATTTAGACTTGG + Intergenic
1075250570 10:120867598-120867620 AAGAGCATTTAAATTAGACTTGG - Intronic
1078540833 11:12211735-12211757 AAGAGCCAGCAAAATAGACATGG + Intronic
1079421691 11:20297202-20297224 AAGAGCTATAAAACTTGGCTGGG - Intergenic
1079892076 11:26068330-26068352 AAGAGCTATCAAACTAAAAGGGG + Intergenic
1079991588 11:27252187-27252209 AATAACTTTCAAATCAGACTTGG + Intergenic
1081180537 11:39980833-39980855 AAGAGCCATTAAATTGGTCTGGG - Intergenic
1081509786 11:43758476-43758498 CAGTGCTTTCAAATGAGACTAGG + Intronic
1083297695 11:61724087-61724109 ACTAGCTATTAAATTAGGCTAGG + Intronic
1089225854 11:116920969-116920991 AACAGCTACCAAATTATAGTTGG - Intronic
1093819245 12:23592776-23592798 AAGAGATATAAAATTACTCTGGG + Intronic
1095577998 12:43761118-43761140 CAGAGCTATTAAATTAGATAGGG - Intronic
1096200973 12:49682640-49682662 AAGTACTATGAAATTAGGCTGGG - Intronic
1096446096 12:51693474-51693496 AAGAGCTATCACTGTAGGCTGGG + Intronic
1097329135 12:58314279-58314301 AATAACTTTCAAATTAGACATGG - Intergenic
1097510903 12:60538486-60538508 AAGAGATATGAAATTGGAATGGG - Intergenic
1100408845 12:94294952-94294974 AAGTGCTATCACAGGAGACTTGG - Intronic
1100673281 12:96839353-96839375 AAGAGCTATCCGATTTCACTTGG + Intronic
1100983769 12:100185819-100185841 AAGATCTGTCAAATGAGATTGGG - Intergenic
1109633418 13:65082727-65082749 AAGAGATATGAAATTATACCAGG - Intergenic
1112609157 13:100938872-100938894 AAGAGTGAACAAGTTAGACTTGG + Intergenic
1113619426 13:111702902-111702924 ACGAGCTAACAAATTTAACTAGG - Intergenic
1113624955 13:111788163-111788185 ACGAGCTAACAAATTTAACTAGG - Intergenic
1114440015 14:22738737-22738759 AAGAGTTATCAAACTGAACTTGG + Intergenic
1114649219 14:24272951-24272973 AAGGTCTATCAAATCAGACTGGG - Intergenic
1115084795 14:29501406-29501428 AAGAGATATCAAATAATTCTAGG + Intergenic
1115244887 14:31285068-31285090 AAGAGTTAACAAATTAGGCTGGG + Intergenic
1115383437 14:32767353-32767375 AAAAGCTATCAAATAAAACAGGG - Intronic
1116050151 14:39792593-39792615 AAGAGACATCAAATTAGACTAGG - Intergenic
1116400562 14:44501125-44501147 AAGAGCTAATAAATGAGATTGGG + Intergenic
1117321291 14:54625871-54625893 AAGAGATACCAAATTAGAGCGGG - Intronic
1117473640 14:56071702-56071724 AACAGCTGTCAAAGTAGCCTTGG + Intergenic
1117806512 14:59497558-59497580 AAGAGGTAGCAAACAAGACTAGG + Intronic
1120545003 14:85800538-85800560 AAGAGCTTTCCATTTGGACTTGG - Intergenic
1123446039 15:20330927-20330949 AAGGGACATCAAATTTGACTGGG - Intergenic
1123962147 15:25414767-25414789 AAAAGCAATCAAAAAAGACTGGG - Intronic
1124665612 15:31589221-31589243 AAGAGATATCAAAATAGCCTTGG + Intronic
1124805640 15:32879389-32879411 AAGAGCTAATAAATTAGACATGG + Intronic
1127675886 15:61238574-61238596 AAAAGCTGTCAAACTAGCCTGGG + Intergenic
1128867788 15:71128193-71128215 AACAGATATAAAAATAGACTGGG + Intronic
1130899803 15:88198782-88198804 AAGAGCTGTCTAAGTAGCCTGGG + Intronic
1135051814 16:19199443-19199465 AATATCTATCATATTAGGCTGGG + Intronic
1138316575 16:56075561-56075583 AACAGCTATGGAATAAGACTGGG - Intergenic
1138467685 16:57204416-57204438 AATATCTATAAAATCAGACTAGG + Intronic
1138481552 16:57306726-57306748 AAGAACTGTCATATTAGGCTGGG - Intergenic
1139351721 16:66340947-66340969 AAATGTTATCAAATTAGGCTGGG - Intergenic
1139681527 16:68568174-68568196 AAGAGCTATCAAAACAGACATGG - Intronic
1140853146 16:78953411-78953433 AACAGGTTTCAAATTTGACTAGG - Intronic
1142929379 17:3269782-3269804 AAGAGCTACCAAGTCTGACTTGG - Intergenic
1144283930 17:13754072-13754094 AACAGACATCAAATTAAACTGGG - Intergenic
1145177807 17:20716904-20716926 CAGAGCCATCAAATTGTACTGGG + Intergenic
1150221647 17:63498931-63498953 AAGAGCTTTCAAAACAGGCTGGG - Intronic
1151088515 17:71408468-71408490 TAGAGATATCAACTAAGACTTGG + Intergenic
1151619121 17:75234439-75234461 AAGAGCATTCAAAACAGACTTGG - Intronic
1151923735 17:77177956-77177978 CAGAGCTGTCAAATTAGGTTTGG + Intronic
1154405573 18:14086903-14086925 AAAAGATATCAAATCAGACAAGG + Intronic
1155537363 18:26831363-26831385 AAGAATTATCAACTTTGACTTGG - Intergenic
1156162924 18:34381954-34381976 GAGAGATATCAAATGAGGCTGGG + Intergenic
1159474982 18:68909999-68910021 AAGAGATAGAGAATTAGACTGGG + Intronic
1162605436 19:11703486-11703508 AAAAGCTAGCATTTTAGACTTGG + Intergenic
1163681092 19:18683233-18683255 AAGAGCTCTGAAAACAGACTAGG - Intergenic
1163869955 19:19812392-19812414 AAGAGCTAGTAAATCAGAATGGG - Intronic
1163874381 19:19854657-19854679 AAGAGCTAGCAAATCAGAACGGG - Intergenic
1163876398 19:19873300-19873322 AAGAGCTAGCAAATCAGAACAGG + Intronic
1163880003 19:19911144-19911166 AAGAGCTAGCAAATCAGAATGGG + Intronic
1163912740 19:20211659-20211681 TGGAGCTAGCAAATTAGAATAGG - Intergenic
1163970360 19:20787812-20787834 ATGAGCTAGCAAATCAGAATGGG + Intronic
1164124661 19:22301858-22301880 AAGAGCTAGCAAATCAGAAGAGG + Intronic
1165126051 19:33598331-33598353 AAGAACAATAAAAGTAGACTTGG - Intergenic
1166624248 19:44335356-44335378 AAGAGTTATAATCTTAGACTGGG + Intronic
927103156 2:19803075-19803097 AAAAGCCATCAAAATAGCCTTGG - Intergenic
929265418 2:39913680-39913702 AAGTGCTATCAAATTACAAAAGG + Intergenic
929745691 2:44655711-44655733 CAGAGCTATCCAATTAGAAAAGG + Intronic
932095537 2:68845144-68845166 AAGAGTTATACAATTGGACTAGG + Intergenic
933239958 2:79909320-79909342 AAGAGCTTTCAAATAAGATTAGG - Intronic
933348162 2:81117168-81117190 AAGAGCTATAAAAATACATTAGG + Intergenic
936789392 2:116133159-116133181 AAGTGCTATCTGATAAGACTGGG - Intergenic
936941698 2:117890530-117890552 AAGAGCCAGCAAATGAGACATGG - Intergenic
937219367 2:120332972-120332994 AAGAGCTATCACAGTAGAGTGGG - Intergenic
937498862 2:122455543-122455565 AAGAGCTACCAAAGTAGAGCTGG + Intergenic
937556800 2:123168019-123168041 AAGTGCTATAAAAATAGGCTTGG - Intergenic
938993203 2:136650742-136650764 CAGGGCTAACAAAATAGACTTGG - Intergenic
940367116 2:152860586-152860608 AAGAACTCTCAAATTTGTCTGGG - Intergenic
940532656 2:154899236-154899258 AAAAGACATCAAATAAGACTTGG - Intergenic
940921358 2:159311130-159311152 ATGAGCCATCAAATTAACCTTGG - Intergenic
941487233 2:166097545-166097567 AAGAGATATAAAATTATATTTGG + Intronic
941951637 2:171161465-171161487 AAGAGCTATGAAAATAAACATGG + Intronic
945123100 2:206479105-206479127 AAGAGCTAGTAAATCATACTGGG - Intronic
945537944 2:211043090-211043112 AAGATCTATGAAAATACACTTGG + Intergenic
1170482324 20:16778486-16778508 AAGAAATATAAAATGAGACTGGG + Intergenic
1174997091 20:55582512-55582534 AAGAGTTATTAAATTAAACCTGG + Intergenic
1175082021 20:56428709-56428731 AAGAGTTAGCAGATTAGAGTAGG + Intronic
1177217042 21:18144039-18144061 AATAGCTTTCAAATTAATCTGGG - Intronic
1178227249 21:30736565-30736587 AAGAGATATAAAATGCGACTGGG - Intergenic
1180202291 21:46231623-46231645 AAGAGCTATCTAAAGAGACATGG + Intergenic
1182031004 22:27159426-27159448 AACATCAATCAGATTAGACTAGG - Intergenic
949946133 3:9191555-9191577 GAGAGCTCTCCAGTTAGACTAGG + Intronic
950830535 3:15871201-15871223 AAGAGCCAGCAAAGAAGACTGGG + Intergenic
951379393 3:21964785-21964807 AAGATCTGTGAAATTAGGCTGGG - Intronic
953003902 3:38959839-38959861 AAGAGCTAGCAAACTAATCTTGG - Intergenic
953603821 3:44394474-44394496 AAGATCTGTCAAAGCAGACTGGG + Intronic
954226644 3:49185979-49186001 AAGAGCTATAAAATTATAGCCGG - Intronic
954362574 3:50129954-50129976 CAGAGCTAGCAAATCAGACATGG - Intergenic
956041000 3:65144718-65144740 AATAGCTATCTTATTGGACTAGG - Intergenic
956651431 3:71508069-71508091 AAGAGCTTTGGAATAAGACTTGG - Intronic
956928963 3:74020926-74020948 AAGAGCAATCAAATTAATTTGGG - Intergenic
958055141 3:88400539-88400561 AAGACCTATACAATTAGATTAGG - Intergenic
959374278 3:105568854-105568876 AAGAGTTAACAAAGTACACTTGG + Intronic
959385827 3:105705045-105705067 AAGAGCTAGTAACTTAGACTTGG - Intronic
962870413 3:139485421-139485443 AAAAGCTTTCAAATTAGAGCTGG - Intergenic
965856566 3:173095907-173095929 AAGAGAAATGACATTAGACTTGG + Intronic
970906043 4:21217694-21217716 AAGAGCAATAAAATCAGCCTTGG + Intronic
971004857 4:22361804-22361826 AATATCTAAAAAATTAGACTAGG - Intronic
971436819 4:26635391-26635413 AAGAGGTACCAAATAAGTCTGGG + Intronic
971936242 4:33151618-33151640 TAGATACATCAAATTAGACTTGG + Intergenic
972191304 4:36594385-36594407 AGGAACTACCAAATGAGACTTGG - Intergenic
972410297 4:38786803-38786825 AAGAACTATAAAAATAGACTGGG - Intergenic
973947348 4:55972356-55972378 AAGAGGTATTAAATTAGAATGGG + Intronic
976622058 4:87138638-87138660 AAAATTTATCAAATTATACTGGG + Exonic
980311061 4:131129330-131129352 AAGAGGTAACAAGTTAGGCTTGG - Intergenic
983621922 4:169771144-169771166 AAGAGCTATCAAACTTCTCTGGG - Intergenic
984515284 4:180731189-180731211 AACAGCTATCAAATCATATTTGG + Intergenic
984623969 4:181984936-181984958 CAGAGAAATCAAATTATACTGGG + Intergenic
984855662 4:184194036-184194058 AAGAGGTATCAAAGGAGACAAGG - Intronic
987270596 5:16304512-16304534 AAGAGCTTGCAAATTAGATGGGG + Intergenic
988263230 5:28917734-28917756 AAGAGCAAGCAAACTAGATTTGG + Intergenic
989359886 5:40589633-40589655 AAGAACTATCCAACTATACTTGG - Intergenic
990070231 5:51773438-51773460 AAGGGCTATCAAACCACACTTGG + Intergenic
990094486 5:52094828-52094850 AGGAGCTACAAAATGAGACTTGG + Intergenic
990517677 5:56545436-56545458 AAGAGCTGTGAATTTGGACTTGG - Intronic
990901703 5:60757777-60757799 AACAACTATCAAATTAGAGGGGG + Intronic
995338411 5:111029605-111029627 ATGAGCTATCAAAGAAAACTTGG + Intergenic
995562199 5:113394710-113394732 AAGAGCTATCAAATTAGACTGGG - Intronic
995584665 5:113635971-113635993 AACAGCCATAAAATTAAACTAGG - Intergenic
995825510 5:116293940-116293962 AAGGCCTATCAAATTTAACTTGG - Intronic
996779321 5:127168080-127168102 AAGAGCAATCAAGTGAGAGTGGG + Intergenic
1003361786 6:5433464-5433486 AAGAGGTAACAAATTACACTTGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1005325062 6:24692139-24692161 AAGAGCCAGCAAAGGAGACTGGG + Intronic
1006983685 6:38164309-38164331 AAGATCTTTAAAATTAAACTAGG + Intergenic
1007426300 6:41748466-41748488 AGGAACTAACAAATCAGACTTGG - Intronic
1008085737 6:47242304-47242326 AAGGCCTATGAAGTTAGACTAGG + Intronic
1010182159 6:73099561-73099583 AAAAGCTATCAAAAGAGACAAGG + Intronic
1012620075 6:101333254-101333276 AAGACCTAACAAATAACACTTGG - Intergenic
1013382847 6:109594504-109594526 AAAAACTATCAAATTACACATGG + Intronic
1013703065 6:112797246-112797268 AATAGGTATCAAATTATAATGGG - Intergenic
1013837707 6:114352050-114352072 AAGAGCTATAAAATTAGACTGGG + Intergenic
1014486999 6:122011620-122011642 AAGAGCTCTAAATTAAGACTTGG - Intergenic
1015483630 6:133743721-133743743 TAGAGCTATCAGATGAGACCTGG - Intergenic
1015769920 6:136757877-136757899 AAGATCTATAAAATGAGGCTGGG - Intronic
1015901692 6:138074634-138074656 AAAAGCGGTCAAAGTAGACTGGG + Intergenic
1016602986 6:145884011-145884033 AAGAGCTATTAAATGAGAGCAGG + Intronic
1017892477 6:158650639-158650661 AAGATTTATTAAATTAGAATTGG + Intronic
1021014333 7:15513908-15513930 AGGAACCAGCAAATTAGACTAGG - Intronic
1021343778 7:19497263-19497285 AAAAGCTATTATGTTAGACTTGG - Intergenic
1022005662 7:26263129-26263151 AAGAGGTAGCAAGTTAGAATGGG - Intergenic
1025755580 7:64335627-64335649 AAGAGCTGTCAGATTAAACATGG - Intronic
1026292032 7:69016163-69016185 AAGAGTTATCAAAGGAGATTTGG + Intergenic
1027209921 7:76137622-76137644 AAGAGTTATTTAATGAGACTTGG + Intergenic
1029300299 7:99577652-99577674 AAGAGCTATCAAACTTCTCTGGG - Intronic
1029621687 7:101693959-101693981 AAGAGAAGTCAAGTTAGACTTGG - Intergenic
1030854771 7:114541371-114541393 TAGAGCAATCAAATTAGCATTGG + Intronic
1032358607 7:131233521-131233543 AACATCTACCAAATTAGTCTGGG + Intronic
1032658829 7:133961072-133961094 AAGAGCCCTTAAATTACACTGGG - Intronic
1032910453 7:136422960-136422982 AAGAGCACCCAAATTAGCCTGGG - Intergenic
1033470993 7:141648668-141648690 AATGGCTATCAAAACAGACTTGG - Intronic
1035232739 7:157476239-157476261 AGGAGCCATCAAATTAACCTTGG - Intergenic
1035811915 8:2499361-2499383 AATAGCCATCAAATAAGAATGGG + Intergenic
1036910189 8:12752361-12752383 CAGAGCTAACAAATTAGAGTTGG - Intronic
1038943282 8:32329563-32329585 GAGAGCCATCAACTTAGACTCGG - Intronic
1042464479 8:69111684-69111706 AAGAGAGATCATATGAGACTGGG - Intergenic
1043483614 8:80677089-80677111 AAGAGCCATCAGATGACACTGGG - Intronic
1044738335 8:95301415-95301437 TAGAGCTAGCAAATGTGACTTGG + Intergenic
1045479803 8:102582845-102582867 AAGAGCTTTCAAATTGAACCAGG + Intergenic
1046493030 8:114977929-114977951 AACAACTATGAAATTAGAGTTGG + Intergenic
1046655378 8:116888239-116888261 AGGAGCCATCAAATCAGAGTGGG + Intergenic
1051234174 9:14980895-14980917 AAAAGCTATCAAACTTCACTGGG + Intergenic
1051277785 9:15414042-15414064 AAAAGATATAGAATTAGACTGGG - Intergenic
1052077437 9:24160145-24160167 GAAAGCTATGAAATTAGAATAGG - Intergenic
1055707375 9:79020450-79020472 CAGAGCAATCATTTTAGACTAGG - Intergenic
1056324994 9:85470028-85470050 AAAAGCTCTCAAATCTGACTGGG - Intergenic
1057023186 9:91716668-91716690 AAATGCTCTGAAATTAGACTGGG + Intronic
1060095516 9:120785732-120785754 AAGAGCTATAAAATTGGGCCGGG + Intronic
1060157243 9:121328334-121328356 AATGGCTGTCAAATTGGACTCGG - Intronic
1062109868 9:134776438-134776460 ATGAGCAATCCAGTTAGACTTGG + Intronic
1186661118 X:11667813-11667835 AATATTAATCAAATTAGACTGGG + Intergenic
1189342919 X:40218273-40218295 AAGAGCTACCATATCAGTCTTGG - Intergenic
1193763352 X:85493640-85493662 AATAACTATAAAATGAGACTTGG - Intergenic
1196438107 X:115693027-115693049 CAGAGCCAGCAAATGAGACTTGG + Intergenic
1196822392 X:119712453-119712475 AAGGTCTAACAAATTAGATTTGG + Intergenic
1197838121 X:130716766-130716788 AAGAGCTATTGAATTAAACGTGG - Intronic
1198332002 X:135630659-135630681 AACAGCTATCTTTTTAGACTGGG + Intergenic
1202123878 Y:21552278-21552300 AATAGATATGAAATTAGACATGG - Intergenic
1202155130 Y:21877102-21877124 AATAGATATGAAATTAGACATGG + Intergenic
1202160019 Y:21924215-21924237 AATAGATATGAAATTAGACATGG + Intergenic