ID: 995569449

View in Genome Browser
Species Human (GRCh38)
Location 5:113463953-113463975
Sequence GAGAACAGCAAGAAGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995569443_995569449 16 Left 995569443 5:113463914-113463936 CCTGCAAAGGAGATAGAAAGGAA 0: 1
1: 2
2: 11
3: 98
4: 660
Right 995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG 0: 1
1: 0
2: 2
3: 30
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995569449 Original CRISPR GAGAACAGCAAGAAGACTGT GGG Intronic
901668085 1:10837844-10837866 AAGAAGAGGAAGAAGCCTGTGGG + Intergenic
901902665 1:12379136-12379158 TACAACAGAAAAAAGACTGTTGG + Intronic
902676452 1:18011963-18011985 GAAAACAGCAAGTATATTGTGGG - Intergenic
905092123 1:35438019-35438041 GAGACCAGCAAGGAGATTTTTGG - Intronic
908579810 1:65502807-65502829 GACAACATCAAGAAGCCAGTGGG + Intronic
909476205 1:76083469-76083491 GTGGGCAGTAAGAAGACTGTGGG + Intronic
911042993 1:93606788-93606810 GAGAAACCCAAGAAGACAGTAGG + Intronic
911054609 1:93699360-93699382 ATGAACAGGAAGAAGACTGTAGG - Intronic
912094454 1:106121171-106121193 AGGAACAGCCAGAAGCCTGTGGG + Intergenic
912484818 1:110017898-110017920 GAGTAAAGCAAGAAGGCAGTGGG - Intronic
912533496 1:110343796-110343818 GATAACAGAAAGAAAACAGTTGG - Intronic
912618602 1:111132645-111132667 GAGAACAGGAAAAACACTTTGGG + Intronic
912718083 1:111996216-111996238 GAGGACAGAAAGAAGAATGAGGG + Intergenic
916397502 1:164407173-164407195 GAAAACAGGAAAAAGTCTGTAGG + Intergenic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917506699 1:175633877-175633899 GGGGACAGCAAAAAGGCTGTGGG + Intronic
917520746 1:175746693-175746715 GAGAAAACAAAGAAGACTGAGGG + Intergenic
918244522 1:182647071-182647093 GATCACAGCAAGAATCCTGTGGG + Intronic
918578526 1:186096188-186096210 GAGAAGAGCAAAAATACTTTTGG + Intronic
918729089 1:187967581-187967603 GTAGAAAGCAAGAAGACTGTAGG - Intergenic
918776086 1:188632636-188632658 GAAATCAGCAAGCAGACTGAAGG + Intergenic
920521291 1:206629033-206629055 GTGACCAGCAAGTAGAATGTTGG + Intergenic
921517668 1:216117072-216117094 GAGTAGGGCAAGAAGTCTGTTGG + Intronic
921759763 1:218899592-218899614 GAGAACAGCATGTAAAATGTTGG + Intergenic
924603643 1:245513599-245513621 GAGCAAAGCAAGAACACTGGCGG - Intronic
1064367894 10:14724747-14724769 GAGGACAGGAAAAAGACTGAAGG + Intronic
1064417649 10:15164567-15164589 AAGGACAGCGAGAAGACAGTGGG + Intronic
1064994173 10:21281856-21281878 GGATACAGTAAGAAGACTGTTGG - Intergenic
1066129496 10:32378741-32378763 CAGCACAGCCAGAAGACTCTGGG + Intronic
1066437750 10:35409502-35409524 GTGAACAGAAAAAAGACTGGAGG + Intronic
1068304198 10:55182736-55182758 GAAAACAGGAGGAAAACTGTGGG + Intronic
1071152420 10:82651215-82651237 GAGAACAGGAAGACCACTTTAGG + Intronic
1071797507 10:89022084-89022106 GAGAAAAGAAAAGAGACTGTAGG + Intergenic
1073104827 10:101026562-101026584 CAGAAAAGCAAGAAGGCTGGAGG + Intronic
1074279413 10:112036845-112036867 GAGAAGAGCAAAGAGGCTGTTGG + Intergenic
1075227749 10:120644968-120644990 GAGAAAAGCAAGAGGACAGTAGG + Intergenic
1075955438 10:126519272-126519294 GAGAATAGCAAGTAGAATATTGG + Intronic
1076224000 10:128758782-128758804 AATAACAGCAAAAATACTGTGGG - Intergenic
1076660644 10:132053948-132053970 GAGAACAGCATGAACCCTGGAGG + Intergenic
1076812930 10:132898577-132898599 GAGAACAGCAAGCAGAGGGCAGG - Intronic
1078146299 11:8723818-8723840 GGTCACAGCAGGAAGACTGTGGG - Intronic
1078582309 11:12547932-12547954 AAGAACAGTAAGGAGACTGTGGG - Intergenic
1079373805 11:19873836-19873858 GAGAGCAGCAAGAACACAGAGGG + Intronic
1079387274 11:19991602-19991624 GAGTATAGCATTAAGACTGTGGG + Intronic
1080206879 11:29739754-29739776 GAGAATAGCAAGAACACAGGAGG - Intergenic
1080695077 11:34596509-34596531 GAGAAGAGCCAGAATACTGTAGG + Intergenic
1080758092 11:35221448-35221470 GATTAAAGCAAGAAGGCTGTTGG + Intronic
1080851552 11:36074580-36074602 GAGAGCAGCATGATGACTCTAGG + Intronic
1080859329 11:36139701-36139723 GAGGGCAGCAAGAAGGCAGTTGG + Intronic
1082801169 11:57416011-57416033 ATGCACAGCACGAAGACTGTAGG - Intronic
1083489081 11:63001566-63001588 CAGAACAGCAGGAAGCCTGACGG - Intronic
1084054525 11:66623994-66624016 GAGAATGGGAAGAAGGCTGTAGG + Intronic
1085212222 11:74791506-74791528 GAGGACAGGAGGAAGGCTGTGGG - Intronic
1085700929 11:78745716-78745738 GAGAACAGGAAGAAAATTTTAGG - Intronic
1087911027 11:103753591-103753613 TAGAAAAGAAAGAAGACTTTAGG + Intergenic
1088550621 11:111009242-111009264 GATACCAGTGAGAAGACTGTCGG + Intergenic
1088563931 11:111147450-111147472 GAAAAAAGCAAGAACACTTTGGG + Intergenic
1090230629 11:125100703-125100725 AAGAACTCCCAGAAGACTGTTGG + Intronic
1090515764 11:127424851-127424873 GGCAACAGCAAGAAGGCTGTGGG + Intergenic
1090714780 11:129420795-129420817 AAGTACAGGAAGAACACTGTGGG + Intronic
1091053338 11:132395097-132395119 GAGAACAGCAACCACACTGCTGG - Intergenic
1094306408 12:29024633-29024655 GAGAACAGCCAGAAAAATGGGGG - Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1094687089 12:32728722-32728744 GAGAACAGCAAGTATAGTGATGG + Intronic
1094735004 12:33224255-33224277 GAGCTCAGCATGAAGACTATTGG - Intergenic
1095896885 12:47288761-47288783 GAGAAAAGAAAGTAGAATGTAGG - Intergenic
1096612008 12:52808289-52808311 GAGAACATCAAGAAGCAGGTGGG - Exonic
1096747446 12:53738132-53738154 TAGAGCAGCAAGAAGGCTGAAGG + Intergenic
1097158212 12:57027985-57028007 GAGACGAGCAAGATAACTGTTGG + Intronic
1097392753 12:59035491-59035513 GGGAAAAGCAAGAAGCTTGTTGG + Intergenic
1098162829 12:67663057-67663079 GAGAAAAGAATGAAGACTGGTGG - Exonic
1099491389 12:83292712-83292734 TAGAGCAGCAAGCAGACTCTTGG + Intergenic
1102325529 12:111979448-111979470 GAAAACAGAAAGCAGACTGGTGG + Intronic
1104101272 12:125613943-125613965 AATAACAGCAAAAAGAATGTAGG - Intronic
1105989045 13:25600091-25600113 GAGTACAGTAAGAAAACTCTAGG + Intronic
1106448924 13:29862397-29862419 GAGACCAGAATGAACACTGTAGG - Intergenic
1108176150 13:47795115-47795137 GAGAAGAGCAGGAAGGCTTTAGG - Intergenic
1109081512 13:57907864-57907886 GAGAAGAGAAATAAGCCTGTGGG - Intergenic
1110183441 13:72644769-72644791 GAGAAAAGGAAGAATACTGTTGG - Intergenic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1111188580 13:84777530-84777552 GAAAACAACAAGAATACTGTTGG - Intergenic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1115585515 14:34808013-34808035 GAGAACAGCATGAACACAGGAGG + Intronic
1115877730 14:37879496-37879518 GAGAACAGCATGAACACAGGAGG + Intronic
1117243914 14:53864351-53864373 AAGAACAGCAAAAACACTGCTGG + Intergenic
1119464732 14:74847548-74847570 TAAAACAGTAAGAAGACTATTGG + Intronic
1120085113 14:80263254-80263276 GAGAACAGCAAGGAGCCAGTGGG + Intronic
1120175649 14:81290546-81290568 GAGAAACTCAAGAAGTCTGTTGG + Intronic
1120230017 14:81831728-81831750 GAGAACATTAAGAGAACTGTGGG + Intergenic
1120543108 14:85776097-85776119 AAGAACACCAGGAATACTGTAGG + Intergenic
1121314560 14:92953298-92953320 CAGAGCAGCAGGAGGACTGTCGG - Intronic
1122467900 14:101946890-101946912 GAGAACAGCATGATGACAGAAGG + Intergenic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122790233 14:104181310-104181332 GAGGATGGCAAGAAGACTCTGGG - Intergenic
1124143989 15:27103834-27103856 AAGAGCAGCTAGAAAACTGTGGG - Intronic
1124160531 15:27264480-27264502 GAGAAAAGAAAGTAGACTATAGG - Intronic
1125484300 15:40101785-40101807 GTTAAAAGCAAGAAGACTCTGGG + Intronic
1126695619 15:51323087-51323109 GAAAACAGGAAGAAGGCAGTAGG - Intronic
1127605209 15:60580154-60580176 TAGAACAGGAAGAAGAGTCTGGG - Intronic
1127834583 15:62780558-62780580 GAGAAGGGCAAGATCACTGTGGG - Intronic
1128708480 15:69854820-69854842 GAGAGAAGCAAGAAGAATGCAGG - Intergenic
1130745036 15:86643371-86643393 GAGAATTGCAAGTAGAATGTTGG - Intronic
1132815586 16:1824897-1824919 GAGCACAACAAGCAGAGTGTGGG + Intronic
1133055729 16:3144611-3144633 GAGAGCAGCAGGAAGACTTTGGG - Exonic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1134316873 16:13126991-13127013 GAGAGAAGGAAAAAGACTGTGGG + Intronic
1136414353 16:30094799-30094821 GAGAACTGCAAGACCACTTTGGG - Exonic
1137741385 16:50779492-50779514 GAGAGGAGCGAGAACACTGTTGG + Intronic
1138085404 16:54129189-54129211 TAGGACAGAAAGAAGACTGCTGG + Intergenic
1139174710 16:64672985-64673007 GACAAGAGCAAGTAGAGTGTAGG + Intergenic
1140431983 16:74912160-74912182 CAGAACAGCAAGGAGAATTTGGG + Intronic
1141640046 16:85335678-85335700 GACAGCAGCAATAACACTGTTGG + Intergenic
1142866044 17:2792199-2792221 GTGCACAGCAAGGAGACTGTGGG - Intronic
1143175570 17:4953068-4953090 GAGAACATCAACAATACTCTGGG + Exonic
1144056397 17:11545705-11545727 TAGGACAGCTAGAAGGCTGTGGG + Intronic
1145239721 17:21233530-21233552 GAGAAGGGGAAGAAGACAGTTGG - Intergenic
1145734194 17:27215020-27215042 GAGAACTTCAAGAAGGCTCTGGG + Intergenic
1146918917 17:36696764-36696786 GAGAACAGAGAGAGCACTGTAGG + Intergenic
1147839610 17:43361917-43361939 AAGTACAGCAAGATGACTTTAGG - Intergenic
1148078092 17:44951099-44951121 GACAACAGCCAGATGACAGTGGG + Intergenic
1149209786 17:54289458-54289480 GAGAACAGCATGAAGCCGGGAGG + Intergenic
1150159931 17:62888185-62888207 TAGAACAGAATGAAGAGTGTGGG + Intergenic
1150189725 17:63225280-63225302 GAGGAAAACAAGGAGACTGTGGG - Intronic
1150199457 17:63339337-63339359 GAGAACAGCCAGAAGACCTGGGG + Intronic
1150238383 17:63611584-63611606 GTGAACAGAAAGAAGAGTGAGGG + Intergenic
1150943443 17:69718727-69718749 AAGAAGAGCAAGAAGACTTTTGG + Intergenic
1150956691 17:69867590-69867612 CAAAACAGCAAGAGGATTGTAGG - Intergenic
1151736278 17:75942606-75942628 CAGAACATCAACAAGACTCTTGG + Exonic
1155270195 18:24133940-24133962 CAGAAAAGCAAGTAGAATGTTGG + Intronic
1155411906 18:25555723-25555745 GAAGATAGCAAGGAGACTGTTGG + Intergenic
1156156545 18:34309440-34309462 AAAAACAACAACAAGACTGTAGG - Intergenic
1156372151 18:36481147-36481169 GAGAAAAGCAACAGGACTGAAGG + Intronic
1156865018 18:41879420-41879442 AGGAACAGCAAGAAAACTGATGG - Intergenic
1157181103 18:45498881-45498903 GGGAACAGAAAGCTGACTGTGGG - Intronic
1157316804 18:46597844-46597866 GAGAACAGCATGAACTCTGGAGG - Intronic
1157348834 18:46866705-46866727 GAGAACAGCAAAAAGAATGGAGG + Intronic
1159300005 18:66551206-66551228 GAGAACTGCAAGATGAGTATTGG - Exonic
1159440079 18:68466956-68466978 GGGAACAGCATGAAGACTTCTGG + Intergenic
1160310025 18:77780471-77780493 GAGAGCAGCAAGCACACTGCTGG - Intergenic
1160404219 18:78634164-78634186 GTGCACAGCAAGGAGAATGTCGG - Intergenic
1160984389 19:1831470-1831492 GAGAACAGCAACAGAACTGGAGG + Intronic
1163397209 19:17070641-17070663 GAGAACCGTAAGGAGGCTGTGGG - Intronic
1164271232 19:23673900-23673922 TAGAACATTAAGAAAACTGTTGG + Intronic
1164719547 19:30422528-30422550 GAGAGCAGGAAGAACACAGTAGG - Intronic
1165896790 19:39146287-39146309 GAGAAGACCCAGAGGACTGTGGG + Intronic
1168241968 19:55092944-55092966 CAGGAAAGCAAGAAGACTATGGG + Intronic
925461842 2:4069953-4069975 GAGAACAGATTGAAGGCTGTGGG - Intergenic
925700486 2:6632363-6632385 GAAAACATCAACATGACTGTTGG + Intergenic
925924054 2:8658095-8658117 GAGGGCAGCAAGAAGACCTTGGG + Intergenic
926771986 2:16386533-16386555 GAGACCAACAAGAACACTGTGGG - Intergenic
926803260 2:16681371-16681393 GAGGACAGCAATAAGACTAGAGG + Intergenic
928676488 2:33656230-33656252 GAGAAAAGCCAGAAGTCTGATGG - Intergenic
928855530 2:35798587-35798609 GAAAAGAGAAAGAAGACTCTAGG - Intergenic
929395037 2:41513061-41513083 GAGAACAGCAAGGAGACTATTGG - Intergenic
931667914 2:64623489-64623511 AGGAACAGCAAGAAGATTGGTGG + Intergenic
931785390 2:65613436-65613458 GAGAACAGACAGCAGGCTGTAGG + Intergenic
932272626 2:70424162-70424184 GAGAAATGCCACAAGACTGTGGG + Intergenic
932479311 2:72029081-72029103 GAGAGGAGCTAGCAGACTGTCGG + Intergenic
932682057 2:73834910-73834932 GAGAAAAGCAAGATGACTCCAGG + Intronic
933084695 2:78040886-78040908 GAGAGAAAGAAGAAGACTGTTGG + Intergenic
933441528 2:82320749-82320771 GAGAACAGCAAGAAGACATTTGG + Intergenic
933529215 2:83485027-83485049 GACCACAGCAAGAACACTGGGGG - Intergenic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
936670835 2:114653986-114654008 GATAACATCAACAAGACTTTTGG - Intronic
937354370 2:121188713-121188735 CAGAACAGCAAGCAGATTGTGGG - Intergenic
938077581 2:128347965-128347987 GAGCAGAGAAAGAAGACTGCAGG - Intergenic
938880459 2:135581133-135581155 GAGACCAGTAAGAAGCCTCTTGG + Intronic
938925665 2:136039287-136039309 GAGAACAGCAAGTAGTTTTTTGG - Intergenic
939269690 2:139921485-139921507 GATAACAGGAATAAGACTGAGGG + Intergenic
939486548 2:142819608-142819630 CATATCAGCAAGAAGGCTGTTGG + Intergenic
939537622 2:143451823-143451845 GAGAAGTGGAACAAGACTGTGGG - Intronic
939639863 2:144627491-144627513 GAGAAGAGCAATAAGAATCTTGG + Intergenic
941515460 2:166469884-166469906 TAGACCAGAAAGAAGCCTGTAGG + Intronic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
944322534 2:198364802-198364824 CAGATCAGCAAAAAGGCTGTTGG + Intronic
944751989 2:202718250-202718272 GAGAGCACCAAGCAGACTGTTGG - Intronic
946685507 2:222265561-222265583 GAGAACAGCGTGAAGCCTGGAGG + Intronic
947199568 2:227602380-227602402 AAGAATTTCAAGAAGACTGTTGG + Intergenic
947394935 2:229677003-229677025 GGGAAGAGCAAGAATTCTGTAGG - Intronic
947829013 2:233125717-233125739 GAGAACAGCAGGAAGGCCATTGG - Intronic
948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG + Intergenic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170053569 20:12174148-12174170 GAGAGCTGAAAGAAAACTGTAGG + Intergenic
1170126131 20:12966185-12966207 GAAAACAGAAAGAAGAAAGTGGG - Intergenic
1170796739 20:19553917-19553939 GAGAACAGCAGGAGGGCAGTAGG + Intronic
1170975309 20:21158673-21158695 GAGAACAGCTAGAGGACTAAAGG + Intronic
1171465374 20:25324198-25324220 GAGAGGAGCAAGGTGACTGTGGG + Intronic
1173298142 20:41777571-41777593 GACAAGAGCAAGAAAACTGGTGG + Intergenic
1174768230 20:53273660-53273682 GAGGCCAGCAAGGAGGCTGTTGG + Intronic
1176840462 21:13837831-13837853 GAGAACAGCATGAAGACAATAGG + Intergenic
1178059098 21:28832363-28832385 GAGAAGAACAAGAAGACTCCAGG - Intergenic
1179831862 21:44001844-44001866 GAGAACAGCAAGGAAAAGGTGGG + Intergenic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1182179335 22:28329111-28329133 TAGGACAGCAAGAAGAAAGTCGG - Intronic
1183264493 22:36816956-36816978 GAGGACATCAAGAAGGCGGTGGG - Exonic
1184657962 22:45951570-45951592 GGGAACAGAAAGCAGACTGGTGG - Intronic
1184807147 22:46802615-46802637 GAGCACAGCATGAAGCCTCTGGG + Intronic
949359848 3:3220177-3220199 GAGAAAAGCTAGAGGACTGGTGG + Intergenic
950003680 3:9677446-9677468 GAGAACAACAAGCAGTCTTTGGG + Intronic
951031131 3:17882639-17882661 GAGACCAGCTTGAAGACTCTAGG + Intronic
951172141 3:19554707-19554729 TAGAACAACAAGCAGACAGTTGG - Intergenic
951327934 3:21327485-21327507 GAGAACAGAAAAAAGAGTGATGG - Intergenic
952232622 3:31447793-31447815 GGGAGCAGCCAGGAGACTGTAGG + Intergenic
952521200 3:34159375-34159397 GAGATCAACCAGGAGACTGTGGG + Intergenic
953095178 3:39767925-39767947 GAGAACAGCAAGGAGAAAGTTGG + Intergenic
953797538 3:45996855-45996877 GAGAACAGAAAGAAAACGGGGGG + Intergenic
955498823 3:59563955-59563977 GAGAACAGCAAGGAAAAGGTTGG - Intergenic
956953031 3:74304184-74304206 GAGAACTGGAAGAAGACAGATGG + Intronic
960316448 3:116184069-116184091 GAGAACAGAAAGTAGAATCTGGG + Intronic
960553303 3:119001012-119001034 AAGAACAGCAAAAACACTGCTGG - Intronic
960629186 3:119711924-119711946 GAGAAAATCTAGAAGACTGTAGG + Intronic
961381073 3:126496990-126497012 GAGAACAGCAGGCAGCCAGTGGG - Intronic
961505574 3:127368751-127368773 GAGAAGAGGAAGAAGGCAGTGGG + Intergenic
961938227 3:130608991-130609013 GAGAACATAAAGAAGAATCTGGG + Intronic
963258453 3:143169671-143169693 GAGACCAGTGAGAAGACAGTGGG - Intergenic
963917180 3:150869509-150869531 AAGAAAAGCAGGATGACTGTCGG - Intergenic
964882325 3:161437256-161437278 GAAAAAAGCAAGAAAACTGCTGG + Intergenic
967046883 3:185745611-185745633 GAGGACAGACAGAAGACGGTTGG - Intronic
967832467 3:193932113-193932135 GAGAACAGGAAGAATTTTGTTGG - Intergenic
971011725 4:22445315-22445337 GGGATCAGCAAGAACAGTGTTGG - Intronic
971663203 4:29447147-29447169 GGGAACAGAAACAAGATTGTTGG + Intergenic
971703049 4:30005712-30005734 GAGAAAAAAAAGAAGAATGTTGG - Intergenic
972166032 4:36285266-36285288 AAGAAAAACTAGAAGACTGTAGG + Intronic
974429745 4:61780335-61780357 GAGAAGAGCAATGAGACTCTAGG + Intronic
974483614 4:62477242-62477264 AAGAACAGTAAGAAAACTATGGG - Intergenic
975067998 4:70093974-70093996 AAGAGAAGCAAGAAGAGTGTTGG + Intergenic
976968255 4:91072162-91072184 GAGAACTGCTAGAAAACTGGGGG + Intronic
977423494 4:96834655-96834677 GAGAGCAGCAAAAAGACTGCAGG + Intergenic
978427205 4:108594971-108594993 GAAAACAGCAAAAAGACAGACGG + Intergenic
978895853 4:113886265-113886287 GAAAACAGCAAGGAGAAGGTGGG - Intergenic
983613407 4:169675074-169675096 GAGATAAGCAAGAACCCTGTTGG + Intronic
986590307 5:9362068-9362090 GAGAAGAGGAAGATGGCTGTGGG - Intronic
986593012 5:9391017-9391039 GAGGACAGCAAGATGACCCTGGG - Intronic
988022813 5:25645106-25645128 GAGAACAGCATGAACCCTGGAGG + Intergenic
988417244 5:30960729-30960751 GAGAAAAGCAAGATGAATGAAGG - Intergenic
989197099 5:38726263-38726285 GAGAAAAGTATGAAGACAGTGGG - Intergenic
989588550 5:43092625-43092647 CAGAACAGCAAAGAGACTTTGGG + Intronic
990409382 5:55525701-55525723 CTAAACAGCAAGAAGACTGAAGG + Intronic
990816773 5:59794597-59794619 GAGAAGGGCAAGAAGAATGGTGG - Intronic
992541846 5:77773787-77773809 GCGAACAGGAAGAAGCCAGTTGG + Intronic
992902470 5:81311888-81311910 AAGGAAAGCAAGAAGACAGTAGG + Intronic
993411493 5:87579165-87579187 GATAAATGCAAGAAGACTGATGG + Intergenic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
994571212 5:101516519-101516541 CAGAAAAGCAAGAAGCATGTGGG + Intergenic
994838252 5:104885812-104885834 GAAAACAGAAAGATGATTGTTGG - Intergenic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
995727841 5:115201449-115201471 GAAAAGAGCATGAAGACTGCAGG - Intergenic
995936163 5:117517783-117517805 GATAAGGGCAAGAAGAATGTGGG - Intergenic
996719939 5:126620083-126620105 GAGAACAGCCAGAAAACTTAAGG - Intronic
997269990 5:132528304-132528326 AAGAACAGCAGGAAGACAGATGG - Intergenic
997875884 5:137546386-137546408 CAGCACAGCAAGCAGGCTGTTGG - Intronic
998202943 5:140139762-140139784 GAGAACAGCAAAATGATTTTGGG - Intergenic
1001694185 5:173657722-173657744 GGGAACTCCAAGAAGATTGTAGG - Intergenic
1001777334 5:174338453-174338475 GAGAACAGGGAGAGGAGTGTGGG - Intergenic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1003238120 6:4316906-4316928 GAGATCAGCCAGAAGCATGTGGG - Intergenic
1003280882 6:4690406-4690428 GAGAACAGCAAGGGGAAAGTCGG + Intergenic
1004320357 6:14627053-14627075 GAGACCACCAAGAGGGCTGTGGG + Intergenic
1004372778 6:15066920-15066942 GAGAACAGAAATCACACTGTAGG - Intergenic
1004443329 6:15674473-15674495 TAGAAAACCAAGATGACTGTTGG - Intergenic
1004575824 6:16893122-16893144 AATAACAGCAACAAGAATGTGGG - Intergenic
1004794925 6:19070807-19070829 GAGAACAGACAGAAGAGAGTGGG - Intergenic
1005080933 6:21955794-21955816 GAGAACAGCAAGTATTATGTTGG + Intergenic
1005737080 6:28757817-28757839 GACAACCGAACGAAGACTGTCGG - Intergenic
1005743740 6:28816683-28816705 GATAACCACACGAAGACTGTCGG - Intergenic
1007514971 6:42403877-42403899 GAGCCCAGCAAGAAGAATGTGGG - Intronic
1009489665 6:64273957-64273979 GAGAACAGAAAGGAGTCTGGAGG - Intronic
1009989173 6:70819978-70820000 GAGAAAGGCAAGCAGACAGTGGG - Intronic
1010584147 6:77637046-77637068 TAGAACTGGAAGAAAACTGTGGG + Intergenic
1011970222 6:93213032-93213054 GAGAACAACAAGAAGGGTGGAGG + Intergenic
1012484994 6:99711222-99711244 GTGAACAGTAAGAAAGCTGTAGG + Intergenic
1014501550 6:122196517-122196539 GAGAACTGCAAGATCATTGTTGG - Intergenic
1015585793 6:134774937-134774959 CACAACAGCATCAAGACTGTAGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1015719965 6:136230709-136230731 CACAACAACAAGAAAACTGTAGG + Intergenic
1015987512 6:138899363-138899385 GAGAAAAGCAAGAAAAGAGTAGG + Intronic
1016169898 6:140999407-140999429 GAGAAAATCAAGATGACTTTGGG - Intergenic
1016320781 6:142843425-142843447 GAGAACAGGAAGAGTTCTGTGGG + Intronic
1018027010 6:159814489-159814511 GGGAACATCAAGAAGACAGCTGG - Intronic
1019015511 6:168877088-168877110 GAGCACAGCATGAGGCCTGTGGG + Intergenic
1019436229 7:1023586-1023608 GAGAACATGACGAAGACTGTGGG + Intronic
1021467112 7:20956813-20956835 GAGCAAAGGAAGAACACTGTAGG + Intergenic
1021804553 7:24342229-24342251 GAGACCAGCTAAGAGACTGTGGG - Intergenic
1023036944 7:36139562-36139584 GAGAACATCAAGCAGATTCTAGG - Intergenic
1023116357 7:36866524-36866546 GAGAACAGAAAGAAGAAAATTGG - Intronic
1023356598 7:39373411-39373433 CAGAACAGGAACATGACTGTTGG - Intronic
1027635498 7:80667704-80667726 AAAAACAGCAAAAACACTGTTGG + Intronic
1027868663 7:83678350-83678372 AAGAAGAGCAAGAAGACAGATGG + Intergenic
1028571877 7:92298053-92298075 GAGAACAGAAAGAATACTGGAGG - Intronic
1028655708 7:93204096-93204118 GAGAACAGGAAAAAGACTCAAGG - Intronic
1028840974 7:95429905-95429927 CAGAGAAGCTAGAAGACTGTGGG + Intronic
1029552610 7:101245320-101245342 GAAAACAGCAAAAAGAGGGTGGG + Intronic
1030186801 7:106770580-106770602 GGTAACAGCAAGATGACTGGTGG + Intergenic
1030620285 7:111782543-111782565 TAGGACAGCAACAAGACTCTAGG + Intronic
1030675102 7:112376132-112376154 GAAAACAGAAAGAAAACTGAAGG - Intergenic
1030715872 7:112806153-112806175 GAGAGGAGCAAGATGACTATTGG - Intergenic
1031200690 7:118681226-118681248 GAGCAAAACAAGAAGACTTTTGG + Intergenic
1032551881 7:132791910-132791932 GAGATCAGCAGGAAGCATGTAGG + Intronic
1033807398 7:144970263-144970285 GAGAACAGGGAGAGGACTTTGGG + Intergenic
1033845754 7:145429729-145429751 GAGAACAGCAAGAGGAGAGAGGG + Intergenic
1034160159 7:148988000-148988022 AAGAACAGCAAAAAGACAGTAGG + Intergenic
1035749770 8:1988629-1988651 GAGACTAGCAAGAAGACTCCAGG - Intronic
1036606801 8:10313628-10313650 GACAACAACAACAAAACTGTTGG - Intronic
1039010797 8:33090718-33090740 GAGACGAGCTAGAAAACTGTTGG + Intergenic
1039039621 8:33395092-33395114 GAGCACTGTAAGAAGACTGAAGG + Intronic
1039903780 8:41771649-41771671 GAGACCTGCAAGGAGACAGTAGG - Intronic
1040307903 8:46221723-46221745 GGGAACAGCAGCTAGACTGTAGG + Intergenic
1041512303 8:58665341-58665363 GAGAAAAGCAAAGAAACTGTGGG - Intergenic
1043278618 8:78434473-78434495 GTGTACAGCATGAATACTGTAGG + Intergenic
1044582804 8:93839035-93839057 CAGAACACCAAGAAGACTGGGGG - Intergenic
1047155224 8:122309641-122309663 GAGAACAGCAAGAACACATATGG + Intergenic
1047203745 8:122787025-122787047 AAGAACAGGAAGCAGACTGTGGG - Intronic
1047464387 8:125098533-125098555 GAGACCAGGTAGGAGACTGTTGG + Intronic
1048607080 8:135980274-135980296 AAGAAAAGCAACAAGACTGAAGG + Intergenic
1053487763 9:38472847-38472869 GAGATCAGCACGATGACTATGGG - Intergenic
1054993905 9:71362391-71362413 CAGAATAGCAAGAAGGGTGTTGG + Intronic
1056211963 9:84373230-84373252 GAGAGGACCAAGAAGGCTGTGGG - Intergenic
1056451738 9:86723184-86723206 CAGAAAATCAAGAGGACTGTTGG - Intergenic
1057143878 9:92745604-92745626 CAGATAAGCAAGAAGACTCTGGG + Intronic
1059648599 9:116292952-116292974 GAGGACTGCAAGAAGACAGGAGG + Intronic
1059814631 9:117898975-117898997 GAGAACAAAAAGATGACTTTTGG + Intergenic
1059906213 9:118989819-118989841 CAGAACAAAAAGAAGACTGATGG + Intergenic
1060232831 9:121838350-121838372 GAGACCAGCGAGGAGGCTGTGGG - Intronic
1060341095 9:122777893-122777915 GAGAATCGCAAGAAGAATGTGGG + Intergenic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1185483592 X:466085-466107 GAGAACTCCAATGAGACTGTAGG - Intergenic
1185959569 X:4534089-4534111 GTGAACAGAAAGCAGACTGGAGG + Intergenic
1189687424 X:43579680-43579702 GAAAAGGGCAAGAAGTCTGTTGG + Intergenic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193684944 X:84566538-84566560 AAGGATAGCAAGAAGACTGGTGG + Intergenic
1195403706 X:104489817-104489839 GAGAACAGGATGAAGAAGGTTGG + Intergenic
1195920507 X:109978679-109978701 GAGATCAGCTGGAAGGCTGTTGG + Intergenic
1196835796 X:119812593-119812615 GAGAAAAACCAGAAGACTCTGGG - Intergenic
1196837827 X:119829611-119829633 GAGAAAAACCAGAAGACTCTGGG - Intergenic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1197409683 X:126099924-126099946 GAGAAAAGAAAGAAAAATGTTGG - Intergenic
1199339932 X:146665708-146665730 GAAAAAAGAAAGAAAACTGTAGG + Intergenic
1201431328 Y:13905812-13905834 GGGAACAGCCACAAGCCTGTTGG + Intergenic