ID: 995573521

View in Genome Browser
Species Human (GRCh38)
Location 5:113506171-113506193
Sequence TTTCCAGGGTGTTCTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995573516_995573521 -7 Left 995573516 5:113506155-113506177 CCCATTCTCTTTCTTATTTCCAG No data
Right 995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG No data
995573514_995573521 12 Left 995573514 5:113506136-113506158 CCATTTTATTTCTGTACCTCCCA No data
Right 995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG No data
995573515_995573521 -4 Left 995573515 5:113506152-113506174 CCTCCCATTCTCTTTCTTATTTC No data
Right 995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG No data
995573517_995573521 -8 Left 995573517 5:113506156-113506178 CCATTCTCTTTCTTATTTCCAGG No data
Right 995573521 5:113506171-113506193 TTTCCAGGGTGTTCTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995573521 Original CRISPR TTTCCAGGGTGTTCTCCTGG TGG Intergenic