ID: 995574169

View in Genome Browser
Species Human (GRCh38)
Location 5:113512462-113512484
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995574169_995574174 27 Left 995574169 5:113512462-113512484 CCTGCTTATCTCGTATTTGCTGA No data
Right 995574174 5:113512512-113512534 AGCCAAAGACAGAGTCCATGTGG No data
995574169_995574175 28 Left 995574169 5:113512462-113512484 CCTGCTTATCTCGTATTTGCTGA No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995574169 Original CRISPR TCAGCAAATACGAGATAAGC AGG (reversed) Intergenic
No off target data available for this crispr