ID: 995574175

View in Genome Browser
Species Human (GRCh38)
Location 5:113512513-113512535
Sequence GCCAAAGACAGAGTCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995574171_995574175 2 Left 995574171 5:113512488-113512510 CCCAATGGCCAAAGCAAGTTACA No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data
995574172_995574175 1 Left 995574172 5:113512489-113512511 CCAATGGCCAAAGCAAGTTACAT No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data
995574168_995574175 29 Left 995574168 5:113512461-113512483 CCCTGCTTATCTCGTATTTGCTG No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data
995574173_995574175 -6 Left 995574173 5:113512496-113512518 CCAAAGCAAGTTACATAGCCAAA No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data
995574167_995574175 30 Left 995574167 5:113512460-113512482 CCCCTGCTTATCTCGTATTTGCT No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data
995574169_995574175 28 Left 995574169 5:113512462-113512484 CCTGCTTATCTCGTATTTGCTGA No data
Right 995574175 5:113512513-113512535 GCCAAAGACAGAGTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995574175 Original CRISPR GCCAAAGACAGAGTCCATGT GGG Intergenic
No off target data available for this crispr