ID: 995579719

View in Genome Browser
Species Human (GRCh38)
Location 5:113583845-113583867
Sequence TTTTAACAAGAATATTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1375
Summary {0: 1, 1: 1, 2: 22, 3: 127, 4: 1224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995579719 Original CRISPR TTTTAACAAGAATATTTTAT AGG Intronic
900008705 1:87009-87031 TTTCAACAAATATATTGTATGGG + Intergenic
900036936 1:421021-421043 TTTCAACAAATATATTGTATGGG + Intergenic
900058564 1:656760-656782 TTTCAACAAATATATTGTATGGG + Intergenic
900078564 1:837471-837493 TTTTGAAAATAAAATTTTATTGG - Intergenic
900708714 1:4097259-4097281 TATTAAGAAGGATATTTTAAAGG + Intergenic
901117865 1:6863265-6863287 TTATAAGATGAATATTTTCTGGG - Intronic
901367831 1:8768993-8769015 TTTTTACAAATAAATTTTATAGG + Intronic
902100989 1:13988836-13988858 TTTTCACAAGTGTATTTTTTAGG - Intergenic
903102517 1:21044311-21044333 TATAAATATGAATATTTTATAGG - Intronic
904241767 1:29151185-29151207 TTTTAGCAAGAATACTTCATAGG - Intronic
904856803 1:33504113-33504135 TTTTGGCAAGAATACTTCATAGG + Intergenic
904885097 1:33731425-33731447 TTTTAGCGAGAATATCTTGTAGG - Intronic
904901485 1:33861291-33861313 TTTTAAAAATAAGGTTTTATTGG + Exonic
905365576 1:37449399-37449421 TTTTAAAATTAAAATTTTATGGG - Intergenic
905835302 1:41114394-41114416 ATTTAATAAGACTATGTTATTGG - Intronic
906912854 1:49974108-49974130 TCTTAAAAAGAATATTAGATAGG + Intronic
906950396 1:50330396-50330418 TTTTTACAACCATATTTTATTGG - Intergenic
907056671 1:51375325-51375347 TGATAACAAGTATATTTTAGAGG + Intronic
907066080 1:51484258-51484280 TTTTAAAAAGAAACTATTATTGG + Intronic
907145698 1:52229261-52229283 TTTTGGCAAGAATACTGTATAGG + Intronic
907393748 1:54175547-54175569 TTTTTAAATGAACATTTTATTGG + Intronic
907645625 1:56240068-56240090 TTTTAACAAGACAACTTTATAGG - Intergenic
907828125 1:58038169-58038191 CTTTTACAAGAATATTTTCATGG - Intronic
907876771 1:58497075-58497097 TTTTGGGAAGGATATTTTATAGG - Intronic
908193106 1:61723657-61723679 TTTTAAAAACATTATTTCATAGG - Intronic
908587652 1:65589786-65589808 TTTTTACATGAATACTTCATTGG + Intronic
909004045 1:70254890-70254912 TTTTTGTAAGAACATTTTATTGG - Intergenic
909026053 1:70483436-70483458 TTTTATCCAAAACATTTTATAGG + Intergenic
909034298 1:70579763-70579785 ATATAACAAGAATATCTAATCGG - Intergenic
909057595 1:70840759-70840781 TTATAAAAAGAATACTTTAGAGG + Intergenic
909083149 1:71138875-71138897 TTTTAAAAATTATATTTTCTTGG + Intergenic
909301029 1:74013574-74013596 TTTTATTAAGAATATTTGTTTGG - Intergenic
909464157 1:75953959-75953981 TTTTTACAAGATTACTTCATAGG + Intergenic
909689284 1:78388826-78388848 TGCTAAGAAGAAAATTTTATTGG + Intronic
909709315 1:78627467-78627489 TTTTTTAAAGAAAATTTTATTGG + Intronic
910078956 1:83315940-83315962 TTTTGACAAGAACATTTTAATGG + Intergenic
910484168 1:87693953-87693975 TTTTAGTAAAAATATTTTACAGG + Intergenic
910796025 1:91098760-91098782 TTTTAGCATGAATATTTAATGGG - Intergenic
910907298 1:92194240-92194262 TTTTTAAAAAAATATTTTTTTGG + Intergenic
910954843 1:92690887-92690909 TTCTGACAAGAATACTTAATAGG - Intronic
911033851 1:93517634-93517656 TTTTTAAAACAAAATTTTATTGG - Intronic
911177380 1:94830509-94830531 TTTTAAAAATAAGATATTATAGG - Intronic
911366029 1:96938407-96938429 TTTTAACATTTATAATTTATTGG + Intergenic
911387666 1:97197109-97197131 TATGAACAAGAACATTTTCTAGG + Intronic
911408626 1:97473061-97473083 TTTTAAGATGAATATGTTCTGGG - Intronic
911542904 1:99180274-99180296 TTTAAAAAATAATATTTTAATGG - Intergenic
911620137 1:100057271-100057293 TTTTATAAATAAAATTTTATTGG + Intronic
911923808 1:103800804-103800826 TTTTTATAAGAATTTTTTAAAGG + Intergenic
912000459 1:104827709-104827731 TTTGAATAGGAATATTTCATGGG - Intergenic
912022993 1:105129629-105129651 TTTTAACAGAAATATTATCTGGG - Intergenic
912138565 1:106693009-106693031 ATTTAAAAAGAAGAATTTATGGG - Intergenic
912305437 1:108561488-108561510 TTTTAAGTAGAATATTTTTAGGG - Intronic
912327207 1:108778187-108778209 ATATAACAAGTAAATTTTATAGG - Intronic
912351133 1:109014748-109014770 TTTTAACAAGAGTTTTTCAGAGG + Intronic
912481953 1:109989359-109989381 TTTAAAAAAGAATATTATATTGG - Intronic
912833797 1:112977660-112977682 TTTTATTAAAAATATTTTATTGG + Intergenic
912982838 1:114392892-114392914 TTATAACAAGAATTATTTACAGG + Exonic
913352192 1:117874307-117874329 TTTTAACAACAAGCTTTCATAGG - Intronic
913421221 1:118671840-118671862 CTTAACCAAGAACATTTTATAGG - Intergenic
913474604 1:119225188-119225210 TTTTAAAAAGAATTTTTTTGTGG + Intergenic
914665757 1:149831315-149831337 TTTTAAAAATAATATTTTTCGGG + Intergenic
914670008 1:149862479-149862501 TTTTAAAAATAATATTTTTCGGG - Intronic
914695550 1:150075443-150075465 TCTTGGCAAGAATACTTTATAGG + Intronic
914772096 1:150696907-150696929 TTTTAAAATTATTATTTTATGGG - Intronic
914946870 1:152074721-152074743 TTCTAAAAAGAATATCTCATGGG + Intergenic
915049439 1:153052288-153052310 TTTTAGCAGGAATATTTGTTTGG - Intergenic
915850940 1:159322282-159322304 CTTTAATATGATTATTTTATGGG - Intergenic
916686397 1:167151352-167151374 TTTTAAAATGATGATTTTATGGG - Intergenic
916908956 1:169323634-169323656 TTTTAACAAGTAGATCTTTTTGG - Intronic
917030778 1:170688532-170688554 TTTTAAACATAAAATTTTATTGG - Intronic
917602400 1:176589798-176589820 TTTCACCAAGTATATTGTATTGG + Intronic
917873322 1:179261956-179261978 TTTGAACAAGCAGATTTAATTGG - Intergenic
918355241 1:183701636-183701658 TTTTTAAAATAATATTTTATTGG + Intronic
918429696 1:184446435-184446457 TTTTGGCAAGAATAATTTATAGG - Intronic
918710757 1:187726316-187726338 TATTAATAAGAATATCTAATTGG - Intergenic
918738272 1:188094755-188094777 TTTTAGCAATTATATTTTATTGG + Intergenic
918775381 1:188623096-188623118 ATTTAACAAAAATAATTTCTAGG - Intergenic
919135472 1:193502835-193502857 TTTCAAAATGAAAATTTTATTGG + Intergenic
919282242 1:195505935-195505957 TTTTTATACGATTATTTTATTGG - Intergenic
919346933 1:196393973-196393995 TTCTAACAACACTATTATATTGG + Intronic
919350169 1:196441576-196441598 TTTAAAGAAGTATATTCTATAGG - Intronic
919355199 1:196513538-196513560 TTTCAACAAGAATATTCATTTGG + Intronic
919432515 1:197513940-197513962 TTTTGGCAAGAATATTACATGGG + Intronic
919545332 1:198910694-198910716 TTTTAACAAGCACATTCTATGGG - Intergenic
919616905 1:199819279-199819301 TTTTATCAAGAAGATTTAAAAGG + Intergenic
919696598 1:200582930-200582952 TTTTAGCAAGAATACTTGGTAGG - Intronic
920458912 1:206122980-206123002 TTTTAGCAAGAGTGTTTCATAGG + Intergenic
920731102 1:208485896-208485918 GTTTCACAAGAACATTTTAATGG + Intergenic
921071582 1:211663192-211663214 TTATAAAAAGAATACTTTCTTGG - Exonic
921122083 1:212145982-212146004 TTTTTAAAAGAAAGTTTTATTGG + Intergenic
921139292 1:212290740-212290762 TTTTACCAAATACATTTTATTGG - Intronic
921332803 1:214056984-214057006 TATAAATAAGTATATTTTATGGG - Intergenic
921697000 1:218223227-218223249 TCTTCATAAGAGTATTTTATAGG + Intergenic
922313572 1:224420466-224420488 TTGTAAAAAGAATATTAAATAGG + Intronic
922511884 1:226175262-226175284 TTTTCACAAGAAGATATTAAGGG + Intronic
922901588 1:229141314-229141336 CTGTAACAAGAATATTTGATTGG + Intergenic
923277130 1:232406401-232406423 TTTTTAAAAGATTATTTTAAAGG - Intronic
923403184 1:233635587-233635609 TTTTAACAAAAAAAAATTATTGG - Intronic
923637917 1:235719671-235719693 TTTTGGCAAGAATCCTTTATAGG - Intronic
923652259 1:235884675-235884697 TTTTAATTAAAATATTTTAAAGG - Intergenic
923818828 1:237411985-237412007 TATTTACAATAAAATTTTATAGG - Intronic
923821296 1:237445702-237445724 TTTTAAAAAGAATATGGTTTTGG + Intronic
924035088 1:239927899-239927921 TTTTAATAAGAACATATTTTTGG + Intergenic
924047666 1:240048881-240048903 TTCTAAAAAGTATTTTTTATAGG - Intronic
1063473599 10:6308876-6308898 TTTTGGCAAGACTACTTTATGGG - Intergenic
1063728924 10:8672992-8673014 GTTTAAGAAGAATAATGTATTGG + Intergenic
1064080755 10:12306353-12306375 TTTTGACAAAAATATTATTTTGG - Intergenic
1064630745 10:17308341-17308363 TTTTAATAAAAACATTTTATTGG - Intergenic
1064667240 10:17667420-17667442 TTTTAAAAAAAAAATTCTATGGG - Intronic
1064763576 10:18647603-18647625 TTTTGCCAAAACTATTTTATTGG + Intronic
1064839184 10:19571595-19571617 TTTTAACAACTATATTTCATTGG - Intronic
1065282986 10:24159343-24159365 TTTTAAAAAGAATATAAAATGGG + Intronic
1065988973 10:30988700-30988722 TCTTAATAGGACTATTTTATAGG + Intronic
1066147083 10:32571440-32571462 CTTCAACAAGAATATTTAAAAGG + Intronic
1066169969 10:32831603-32831625 TTTTAACAAAAATGTTTTAAAGG - Intronic
1066618367 10:37319284-37319306 TTTTAACTAGGATAGTTTTTAGG + Intronic
1067154890 10:43772255-43772277 TTTTGACAAGAATATTTCATAGG + Intergenic
1067852822 10:49765740-49765762 TCTGAATAAGAATATTTTGTAGG + Intergenic
1068033775 10:51735211-51735233 TTTTATGAAGAATACTTTCTAGG + Intronic
1068110248 10:52671826-52671848 TTTTAACAACAAGATTTCACAGG - Intergenic
1068280275 10:54859462-54859484 TTTTAACTAAAAAGTTTTATAGG - Intronic
1068337712 10:55659102-55659124 TTTTAACAAAAACATTATAATGG + Intergenic
1068368633 10:56085225-56085247 TTTTAAGAAAAATATATTTTAGG - Intergenic
1068371391 10:56120662-56120684 TCTTAACAAGAAAATTCTTTAGG - Intergenic
1068461460 10:57335116-57335138 TTTTTACAAGAAGATTATTTTGG + Intergenic
1068691185 10:59916555-59916577 TTTTAGCAAGAATACTTCATAGG + Intergenic
1068702583 10:60035673-60035695 TGTTAACAGGAATTTTTTAAGGG + Intronic
1068857457 10:61812005-61812027 TTTTAAAAATAACACTTTATTGG - Intergenic
1069006312 10:63321195-63321217 TATTACAAAGAATATTTTAAAGG - Intronic
1069240117 10:66128933-66128955 TTTTAAACAGACTATTTTTTAGG - Intronic
1069537080 10:69261998-69262020 TCTGGACAAGAATATTTTCTAGG + Intronic
1069657376 10:70099982-70100004 TTTTACCAAGGATATTTTAAGGG - Intronic
1069724193 10:70566881-70566903 TTTTAGAAAGAACTTTTTATAGG + Exonic
1069860343 10:71467254-71467276 CTTGAACAAGAACATTTTGTAGG + Intronic
1069977635 10:72227570-72227592 TTTGACCAAGAATATTAAATGGG - Intronic
1070231118 10:74568666-74568688 TTTTAATAAAAATATTTATTTGG + Intronic
1071072206 10:81707621-81707643 TTAAAAACAGAATATTTTATTGG - Intergenic
1071660425 10:87496658-87496680 TTTTAACAATAAGATCTCATGGG - Intergenic
1071883629 10:89926517-89926539 TTTTAACACTCATATTTCATCGG + Intergenic
1071951386 10:90706571-90706593 TTTTAATAAAAATATTTCAGTGG + Intergenic
1072146727 10:92647107-92647129 TTTTAGCAAGAGTATTTCATAGG - Intronic
1072179366 10:92966071-92966093 TTTTAACTTAGATATTTTATGGG + Intronic
1072352469 10:94570260-94570282 TTTTAATAAGAATACTTCATTGG + Intronic
1072993994 10:100227220-100227242 TTTCACAAAGAATATTCTATGGG + Intronic
1073041562 10:100611047-100611069 TTTTGGCAAGAATATTTTATAGG - Intergenic
1073090551 10:100935082-100935104 TTTTTACAAGACAATTTTTTGGG - Intronic
1073241195 10:102059353-102059375 TTTTAACAAAATTATTTTTCTGG + Intergenic
1073384757 10:103116126-103116148 TTTTAAAAAAACCATTTTATTGG + Intronic
1073744145 10:106446172-106446194 TTTGGACAAGAACACTTTATAGG + Intergenic
1074074927 10:110114363-110114385 TTTTAAAGAGAATATTTCAATGG - Intronic
1074091522 10:110263350-110263372 TATTACCTAGAATATTCTATGGG - Intronic
1074175980 10:111003540-111003562 TTTAAATAATAATATTTTATGGG - Intronic
1074520201 10:114213735-114213757 TTTGAAAAATAAAATTTTATGGG + Intronic
1076208159 10:128619652-128619674 TTTTAACAAAAATATAATGTGGG + Intergenic
1076425394 10:130363858-130363880 TTTTTTCCAGAATTTTTTATGGG + Intergenic
1077663301 11:4087903-4087925 TTTGGACAAGAAGAGTTTATAGG + Intronic
1077889431 11:6408100-6408122 CTTTTGCAAGAATATTTCATAGG - Intronic
1077952067 11:6970112-6970134 TTTTAACAAGAATATGTCATAGG - Intronic
1078202377 11:9195063-9195085 TTTTAACTAGTCAATTTTATTGG - Intronic
1078590949 11:12640774-12640796 TTTTTTAAAGATTATTTTATGGG + Intergenic
1079680940 11:23297511-23297533 TTTTAACAAAAATATTTTAAAGG + Intergenic
1079744765 11:24110913-24110935 ATTTAACAAAAATATTTTACAGG + Intergenic
1079837701 11:25354915-25354937 ATCTAACAAAAAAATTTTATTGG - Intergenic
1079969834 11:27023147-27023169 TTTTAAAAACAATAATTTGTGGG - Intergenic
1080061932 11:27965638-27965660 TTTGAACAAGAAGATATTTTTGG + Intergenic
1080180139 11:29416031-29416053 TTTTAAGAAAAATAATTTAGGGG - Intergenic
1080195537 11:29604281-29604303 TCTTTTGAAGAATATTTTATGGG + Intergenic
1080223096 11:29929304-29929326 TTTCAATAAGTATATTTAATTGG + Intergenic
1080741458 11:35068377-35068399 TCTCAACAACAATATATTATAGG - Intergenic
1081255025 11:40882127-40882149 TTTTATAAACAAAATTTTATTGG - Intronic
1081397786 11:42607342-42607364 ATTTGTCAAGAATATTTCATAGG + Intergenic
1081544819 11:44064074-44064096 TTTTAAAAAGACTATTTACTGGG - Intergenic
1081555245 11:44153990-44154012 TTTTAATTAAAAAATTTTATGGG + Intronic
1082021791 11:47540400-47540422 TTTCAACAAGGATATTTTACTGG - Intronic
1082189775 11:49228724-49228746 TTTTAATAAAAATATATTTTTGG + Intergenic
1082200444 11:49359898-49359920 TGTTAGCATGATTATTTTATGGG + Intergenic
1082683876 11:56214421-56214443 TTTGAAAAGAAATATTTTATAGG + Intergenic
1084202068 11:67566644-67566666 TTTTTAGAAAAATGTTTTATTGG - Intergenic
1084366465 11:68704203-68704225 TTTTTACTAGAGTATTTTTTAGG - Intergenic
1084561547 11:69908385-69908407 TTTTATCATGAATTTTGTATGGG + Intergenic
1084994138 11:72958787-72958809 TTTTAAAAAGATTATTTCTTAGG - Intronic
1084995363 11:72972109-72972131 TATTAACGAGAGTATTGTATAGG - Intronic
1085650023 11:78259387-78259409 TTTTGACAACAGTATTTGATAGG + Intronic
1085678811 11:78551536-78551558 TTTTTAAAAAACTATTTTATTGG - Intronic
1085983075 11:81748310-81748332 TTTTAAAAATGAAATTTTATGGG - Intergenic
1086100725 11:83096702-83096724 TTTTAAAAATAAAATTTTAAAGG - Intergenic
1086347272 11:85909746-85909768 TTTTAAGAAGTGTATTTTGTCGG - Intronic
1086568602 11:88256830-88256852 GTTTTTTAAGAATATTTTATTGG + Intergenic
1086655233 11:89346344-89346366 TGTTAGCATGATTATTTTATGGG - Intronic
1086768162 11:90725615-90725637 TTTTACCAAGCATATTGTGTAGG + Intergenic
1086796402 11:91109755-91109777 ATTTAACAAAAATGTATTATTGG + Intergenic
1087070139 11:94071116-94071138 TTTTAAATAGTATATTCTATGGG - Intronic
1087431384 11:98060113-98060135 TTTTCTAAAGAAAATTTTATTGG + Intergenic
1087557104 11:99734790-99734812 TTTTAAAGAGACTATTGTATAGG - Intronic
1087584739 11:100104393-100104415 TTTTAAAAAGAATAGTTTTTAGG + Intronic
1087762391 11:102114794-102114816 TTTTTAAATAAATATTTTATTGG + Intronic
1087770374 11:102202866-102202888 TTTTGGCAAGAATACTTCATTGG - Intronic
1087860873 11:103153419-103153441 TTTTATCAAGAGTATTATGTTGG - Exonic
1088210194 11:107445916-107445938 TGTAAACAAAAGTATTTTATGGG + Intronic
1088224860 11:107608686-107608708 TCTAAACCAGAAAATTTTATGGG - Intronic
1088372995 11:109111829-109111851 TTTTAATAATAATATTTTTTTGG - Intergenic
1088406837 11:109490830-109490852 CTCTGAGAAGAATATTTTATGGG + Intergenic
1088542952 11:110932161-110932183 TTTTGACAAGAACATTTCCTAGG + Intergenic
1089091025 11:115875956-115875978 TTTTTCCAATAATGTTTTATAGG + Intergenic
1089208407 11:116783955-116783977 CTTTAACCAGAATATTATAAAGG - Intronic
1089270506 11:117298702-117298724 TTTTCACCAGGACATTTTATGGG - Intronic
1089447852 11:118567599-118567621 TTTTAAAAAGAAAATAATATTGG + Intronic
1089600247 11:119609823-119609845 TTTTATGAATAAAATTTTATTGG + Intergenic
1089886336 11:121827950-121827972 ATTTAACATGTCTATTTTATAGG - Intergenic
1090173839 11:124629874-124629896 TTGTTACAAAAATATTTTCTTGG + Intronic
1090691503 11:129187705-129187727 TTTTTAAAATAATATTTTAGGGG + Intronic
1090817537 11:130312430-130312452 CTTTGGCAAGAATATTTAATAGG - Intronic
1091162758 11:133439974-133439996 TTTTATTAAGATTATTATATTGG - Intronic
1091199269 11:133760993-133761015 ATTTAAGAAATATATTTTATTGG + Intergenic
1091531247 12:1358049-1358071 TTTGCCCAAGAATATATTATAGG + Intronic
1091800634 12:3322476-3322498 TTTTAAAAAGAACAGTTTATGGG + Intergenic
1091868362 12:3863038-3863060 TTTTTTCAAGAATGTTTTGTAGG + Intronic
1092299498 12:7232333-7232355 TTTTAACAAGACTACTTCTTAGG + Intergenic
1092403787 12:8200967-8200989 TTTTAAAAATCATATTTAATAGG - Intergenic
1092724944 12:11475731-11475753 TTTTAACAATCATATCTCATGGG - Intronic
1092847916 12:12601247-12601269 TTCTAATAATACTATTTTATTGG + Intergenic
1092985534 12:13841871-13841893 TTTTAAAAAAAATATGGTATAGG + Intronic
1093078040 12:14777101-14777123 TTTTAACCCGAATAGTTTACGGG + Intronic
1093216659 12:16369583-16369605 TTTTATAAATAATGTTTTATTGG + Intronic
1093403168 12:18772129-18772151 TATCAAGAAGAATATTTTCTAGG - Intergenic
1093438207 12:19162282-19162304 TGTTTACATGAATATTTCATTGG - Intronic
1093444392 12:19239573-19239595 TTTTAACAAATATATTATTTTGG + Intronic
1093560939 12:20538972-20538994 TTTTAAAAAGAATAACTGATTGG - Intronic
1093640502 12:21522019-21522041 ATTTAACAAAAACATTCTATTGG + Intergenic
1093736629 12:22626705-22626727 TTTTAAGCAGATTATTTTAAAGG + Intronic
1093799603 12:23357241-23357263 TGGTAATAAGAATATTTTAGGGG + Intergenic
1093848299 12:24002656-24002678 TTTCCACAAAAATACTTTATAGG + Intergenic
1094013497 12:25835061-25835083 TTGTTACAAAAATATGTTATGGG - Intergenic
1094109036 12:26841589-26841611 TATTCAGAAGAATATTTTAATGG - Intergenic
1094662723 12:32486116-32486138 TTATGAAAAGAATCTTTTATGGG + Intronic
1094795624 12:33968448-33968470 TTTTAACAATATTAGTTTTTTGG - Intergenic
1095155429 12:38847664-38847686 TTTTACCATGCATATTTTAGAGG + Intronic
1095157801 12:38879645-38879667 TTTTAACAAGAATATTTATTAGG - Intronic
1095329408 12:40939878-40939900 TTTCTACAAAAATATTTAATAGG - Intronic
1095828486 12:46556557-46556579 ATTAATCAAGAAAATTTTATTGG - Intergenic
1096343158 12:50820617-50820639 TTTTAAAAATAATATTTTAAGGG - Exonic
1097417979 12:59337246-59337268 TTTTAAATAAAATATTTTAAAGG - Intergenic
1097474791 12:60039818-60039840 TTTTAACTATAATATTCTGTTGG - Intergenic
1097639903 12:62168315-62168337 TTTGGGCAAGAATATTTCATAGG - Intronic
1097839703 12:64309851-64309873 TTTTAACAAAAATACTTCATAGG + Intronic
1098184638 12:67883355-67883377 TTTTAACAAGCATTTTTTTTGGG - Intergenic
1098215866 12:68217726-68217748 TTTTAGCTAGAACACTTTATAGG - Intronic
1098232338 12:68384667-68384689 TTTTAACAAGAGTAATGAATTGG + Intergenic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1098323337 12:69274678-69274700 TTGTAGCAAAAATATTTTACTGG + Intergenic
1098381803 12:69877940-69877962 TTTTAAAAATAAAATTTTACTGG + Intronic
1098802072 12:74973270-74973292 TTTTTGCAAGAATATTTGGTAGG - Intergenic
1098813620 12:75128403-75128425 TTTTTATAACAATATTTAATAGG - Intronic
1098824509 12:75277370-75277392 TTTTAACAAGAACAATTTGTAGG + Intronic
1098879993 12:75907367-75907389 TTTTAAGAAGACAATTATATTGG + Intergenic
1098933325 12:76447373-76447395 TTTTGGCAAGAATACTTTGTAGG - Intronic
1098943776 12:76567433-76567455 TTTTATCAAGAAAATATTCTAGG - Intergenic
1099135828 12:78899829-78899851 TTATAGCTAGATTATTTTATAGG + Intronic
1099269642 12:80491531-80491553 TTTTAAAAAGTAGCTTTTATGGG + Intronic
1099331027 12:81287621-81287643 TTTTAACAAGTTTATTTTATAGG + Intronic
1099346106 12:81501763-81501785 TTTTAAAAAGAATATGCTAAAGG + Intronic
1099353908 12:81610189-81610211 TTTTAACAAAAAAATCTTAAAGG - Intronic
1099443402 12:82725366-82725388 TTTTAATATTAATTTTTTATTGG + Intronic
1099500776 12:83411388-83411410 TTTTAACTAAAATGTTTTCTGGG + Intergenic
1099528060 12:83740658-83740680 TTTTTAAAAAAATATTTTATGGG + Intergenic
1099615978 12:84936893-84936915 TGTTCTCAAGAATATCTTATTGG + Intergenic
1099630393 12:85135322-85135344 TTTTAGCAAGAATATTTCATAGG + Intronic
1099647120 12:85371766-85371788 TTTTAACAGGAAGCTTTTAATGG + Intergenic
1099873717 12:88379337-88379359 TGTCAACAAGACTATTTAATGGG - Intergenic
1100008653 12:89925528-89925550 TTTTAACAGGTATATGTGATCGG - Intergenic
1100071265 12:90721505-90721527 CTTTAACAAGCATTTTTTGTGGG + Intergenic
1100188951 12:92169972-92169994 TTTTATAAAGAATATTTGAGGGG - Intergenic
1100257610 12:92900456-92900478 TTAAAACAAGAAAATTTTGTGGG - Intronic
1100327357 12:93551974-93551996 TTTTAAAAAATATTTTTTATTGG + Intergenic
1100436443 12:94575642-94575664 TTTTAACAAACATATTTTAGTGG - Intronic
1100727051 12:97419698-97419720 TTTTAAAAGGAATGTTTTAGCGG - Intergenic
1100742705 12:97612104-97612126 TTTAAACATTAATATTATATTGG - Intergenic
1100814616 12:98374263-98374285 TTTTATAAATAAAATTTTATTGG + Intergenic
1101179237 12:102193352-102193374 TTTTATTTAGAATATTTTATGGG + Intronic
1101268944 12:103122567-103122589 TTATAAAAATATTATTTTATCGG - Intergenic
1101503096 12:105322001-105322023 TTTTGAAAATAATGTTTTATTGG - Intronic
1101560828 12:105856166-105856188 TTTTATAAAGAAAATTTTACTGG - Intergenic
1101634700 12:106529277-106529299 TTTAAAGAATAATAATTTATTGG + Intronic
1101939037 12:109085610-109085632 TTTTAACAAAAAGACTTTATAGG - Intronic
1102668156 12:114594085-114594107 TTTTGACAAGAGTAATTCATAGG - Intergenic
1102775842 12:115518286-115518308 TTTTAACAGGATAATATTATGGG + Intergenic
1102818891 12:115891341-115891363 TTTTGAAAATAAAATTTTATTGG - Intergenic
1103198137 12:119064061-119064083 AATTAACAAGAAAATTTTAATGG + Intronic
1103392157 12:120582443-120582465 TTTTAAAAAAAATGTCTTATGGG + Intergenic
1103873781 12:124111496-124111518 TTTTTAAGAGAATTTTTTATAGG + Intronic
1104030520 12:125062602-125062624 TTTTAAAAAGATTTTTTTAAAGG - Intergenic
1104095659 12:125555274-125555296 TTTAAATAGGTATATTTTATTGG + Intronic
1104249134 12:127073644-127073666 TTATAACAATATAATTTTATTGG + Intergenic
1104332506 12:127860372-127860394 CTTTAATTAGAATATTTTAGAGG + Intergenic
1104704240 12:130931359-130931381 ATTTAAAAAGAATAGTTTCTGGG + Intergenic
1104951856 12:132444733-132444755 TTTTTACTAGAATCTTTTAAAGG + Intergenic
1105577326 13:21666340-21666362 TTTTAACAAGAAAAATTAAGGGG - Intergenic
1105606800 13:21932662-21932684 TTTTAACAAGAATTAATTACTGG + Intergenic
1105617398 13:22031203-22031225 TTTTAAATAAAATATTTTTTTGG + Intergenic
1105656838 13:22450952-22450974 CTTTCACAAGAATCTTTTTTAGG - Intergenic
1106706717 13:32288531-32288553 TTTTAGGAAGAATATTCTATTGG - Intronic
1107001920 13:35557556-35557578 TTATAACATGAAGATTATATGGG + Intronic
1107124281 13:36829445-36829467 CTTTACCAAGGATATTTTTTAGG + Intergenic
1107529566 13:41269597-41269619 TTCTAACAAAAATATATTGTAGG - Intergenic
1107626283 13:42288911-42288933 TTATGGCAAGAATACTTTATAGG + Intronic
1107794238 13:44033616-44033638 TTTTAACAAGTCTATGTAATAGG - Intergenic
1108166334 13:47697039-47697061 TTTTTAAAAGAATTTTTTGTGGG + Intergenic
1108376299 13:49817279-49817301 TTTTGACAAGGTTATTTCATAGG + Intergenic
1108539922 13:51431881-51431903 TTTTAACATGAATATTACAGAGG - Intronic
1108571676 13:51757843-51757865 TTTTAATTAGACTATTTTACTGG + Intronic
1108784980 13:53888602-53888624 TTTTATCAAGAGTATATTGTTGG + Intergenic
1108870636 13:54980311-54980333 TTTGAAAAAGATTATTTTTTAGG + Intergenic
1108930638 13:55813728-55813750 TTTTAGCAAGAAAACTTCATAGG - Intergenic
1109489929 13:63084195-63084217 TTTCATCAAGGATAATTTATTGG - Intergenic
1109608256 13:64728402-64728424 TTTTTTCAACAATATTTTGTGGG + Intergenic
1109885672 13:68540728-68540750 ATTTAACATAAATATTTTCTAGG - Intergenic
1109897939 13:68718961-68718983 TTTTAACAAAAATGTTTAAAGGG + Intergenic
1109905504 13:68834948-68834970 TTAAAACAAGAATAATATATTGG - Intergenic
1109936590 13:69293759-69293781 TTTCAACAAGCATATTTGAATGG - Intergenic
1109984568 13:69961849-69961871 ATTTAAAAATACTATTTTATTGG - Intronic
1110468949 13:75836289-75836311 TTTTAACAAGATGAGTTTCTCGG - Intronic
1110932202 13:81235274-81235296 TTATAATAATGATATTTTATAGG + Intergenic
1111213394 13:85109985-85110007 TGTTAAACATAATATTTTATTGG + Intergenic
1111353609 13:87066690-87066712 AATTAATAAAAATATTTTATTGG - Intergenic
1111378645 13:87415407-87415429 TTTTGTAAATAATATTTTATTGG - Intergenic
1111378812 13:87418483-87418505 TTTTAACCATAAAATTTTGTAGG - Intergenic
1111500663 13:89116713-89116735 TTATATCAACAATAGTTTATTGG + Intergenic
1111565579 13:90010518-90010540 TTATAATAAGAATATTGCATTGG + Intergenic
1111762975 13:92488935-92488957 TTTTAACAAGTAAATTTCAGGGG + Intronic
1111815403 13:93146841-93146863 TTTTAATAAGAATACTTTATGGG + Intergenic
1111817475 13:93171764-93171786 TTTTTAACACAATATTTTATAGG + Intergenic
1111837523 13:93406976-93406998 TTTTAAAAAGAAAATTTAAATGG + Intronic
1111896969 13:94154317-94154339 TTTTAAAAGGCATATTTTAGTGG - Intronic
1111900326 13:94192051-94192073 TATTAAAAAAAATAGTTTATAGG + Intronic
1111976552 13:94972145-94972167 TTTTGAAAAGAATGTTTAATTGG - Intergenic
1112065263 13:95785762-95785784 TTTGATCAAGAATATTTAAGAGG - Intronic
1112143042 13:96667696-96667718 TTTTAACAAGAATAGCAAATGGG - Intronic
1112505581 13:99972782-99972804 ATTTCAAAATAATATTTTATTGG - Intergenic
1112584948 13:100710651-100710673 TTTTAACAAAAATGTTTAAAAGG - Intergenic
1112667396 13:101591255-101591277 TATTAACAATTATATTTCATAGG - Intronic
1112722734 13:102263258-102263280 TTTTAAAAAGCAGATTTTATAGG + Intronic
1112747006 13:102537784-102537806 CTTTAACAAGAATCTTTTGGTGG + Intergenic
1112796637 13:103064248-103064270 TATTAAAAAAAATAATTTATAGG + Intronic
1113186758 13:107695733-107695755 TTGTTACAAGAATATGTTAGAGG - Intronic
1113497896 13:110747702-110747724 TTTTAACAGTTACATTTTATGGG + Intergenic
1114419105 14:22565293-22565315 TTTTTCAAAGAACATTTTATGGG + Intronic
1114911575 14:27205810-27205832 ATTAAAAAAGAATATGTTATGGG - Intergenic
1115097748 14:29658489-29658511 TTTTTTTCAGAATATTTTATGGG + Intronic
1115349249 14:32375703-32375725 TGTTAACAACCCTATTTTATAGG + Intronic
1115351825 14:32404093-32404115 TTTCAAAAAAAATATTTCATGGG - Intronic
1115365670 14:32554151-32554173 TTTTTAAAATATTATTTTATTGG + Intronic
1115672752 14:35633681-35633703 TTTTGATAATAGTATTTTATAGG - Intronic
1115807618 14:37069654-37069676 TTTTTACAAATAAATTTTATTGG - Intronic
1116265110 14:42678061-42678083 TTTTAACACTATTATTTTATTGG - Intergenic
1116321763 14:43476776-43476798 ATTTAACAAAAATATTTATTTGG - Intergenic
1116347260 14:43810378-43810400 TTTTTAAAACAATGTTTTATAGG - Intergenic
1116380371 14:44260609-44260631 TTTTAAAAAGAAGATCTCATAGG + Intergenic
1116585032 14:46692833-46692855 TTTCAACATGAAAATTTGATTGG + Intergenic
1116626658 14:47273338-47273360 TTTGAATAACAATATTTTAGTGG + Intronic
1116645338 14:47521344-47521366 TTTTAACAAGAACATTTACCAGG + Intronic
1116668257 14:47806827-47806849 TTTTTATAAAAATATTTGATAGG + Intergenic
1116684549 14:48020725-48020747 GTTTTTGAAGAATATTTTATAGG + Intergenic
1117102073 14:52360010-52360032 TTTTGGCAAGAATACTTCATAGG - Intergenic
1117155499 14:52936232-52936254 ATTTAGTAAGAATATTTAATTGG + Intronic
1117296450 14:54384167-54384189 TTTTGAAAGGAATCTTTTATCGG - Intergenic
1117620765 14:57584049-57584071 TTATAGTAAGCATATTTTATAGG + Intronic
1117668750 14:58083986-58084008 TTTTAACAAGTATGAATTATTGG + Intronic
1117843700 14:59888613-59888635 TTTTTATAAGGATATGTTATTGG - Intergenic
1117907611 14:60606492-60606514 TTTTGGCAAGAATATTTTATAGG + Intergenic
1118023802 14:61747616-61747638 TTTTAAGAAGAAATTTTTTTTGG + Exonic
1118451398 14:65905807-65905829 TTTTATGAATAAAATTTTATTGG + Intergenic
1118842005 14:69520466-69520488 CTATAAGAAGAAAATTTTATTGG + Intronic
1118913591 14:70082218-70082240 TCTTATCAAGGATATTTAATTGG - Intronic
1118918766 14:70130876-70130898 TTTCTACCTGAATATTTTATAGG - Intronic
1119236248 14:73021926-73021948 CTTTAAAAAGAATGTTTTTTTGG - Intronic
1119965060 14:78905347-78905369 TTTTTATTTGAATATTTTATAGG + Intronic
1119971394 14:78974599-78974621 TTTTAACATTATTACTTTATTGG + Intronic
1120115047 14:80605937-80605959 TTTATACTATAATATTTTATTGG - Intronic
1120270342 14:82305407-82305429 TTTTGACAGGAATATTTTTGGGG - Intergenic
1120422625 14:84307485-84307507 TTTTGAGAAGGATATTTTTTAGG - Intergenic
1120462117 14:84810997-84811019 TTATCACAATAATATTTTGTAGG + Intergenic
1120626533 14:86833406-86833428 ATTTAAAAATAATATTTTTTGGG - Intergenic
1121572215 14:94954979-94955001 TGTTAACATGCATATTTTAAGGG + Intergenic
1122679731 14:103449458-103449480 TTGTAAAAAGAATATTTCAGAGG + Intronic
1124003947 15:25781358-25781380 TTTTAAAAAGAATATTTGGCCGG + Intronic
1124067564 15:26359682-26359704 TCTTTTAAAGAATATTTTATAGG - Intergenic
1125182896 15:36897541-36897563 TTTGTACATGAATATTTGATGGG - Intronic
1125549503 15:40534828-40534850 TTTCAACATGTATATTTTAGAGG + Intronic
1126261978 15:46704059-46704081 TTTTAACAAGAAGCTCTTGTGGG - Intergenic
1126649999 15:50910561-50910583 GTTTAAAAAAAATATTTTTTTGG + Intronic
1126729244 15:51665229-51665251 TTTTGGCAAGACTATTTTAGTGG + Intergenic
1126783610 15:52159107-52159129 TTTTTACATCAATATTTTTTAGG + Intronic
1126883472 15:53124172-53124194 TTTTAGCAATGAAATTTTATTGG + Intergenic
1126909184 15:53400294-53400316 TTTTTAAAACAAAATTTTATTGG - Intergenic
1126998517 15:54474918-54474940 TTTTAACAATTAGATTTTATGGG + Intronic
1127069707 15:55276992-55277014 TTTTAAAAAAACTACTTTATGGG - Intronic
1127162009 15:56198447-56198469 TTTCAGCAAGAATACTTTGTAGG - Intronic
1127241664 15:57122476-57122498 TTTTAACAGCATTATTTTATGGG + Intronic
1127672534 15:61209542-61209564 CTTTAACATGTAAATTTTATGGG - Intronic
1127789562 15:62387763-62387785 TTTTAACAAGATTACATTTTGGG - Intergenic
1128174750 15:65545279-65545301 TTTTAACAAAAATATTTCATAGG - Intronic
1128289710 15:66468630-66468652 TTTTAAAAAAAATTTTTTTTTGG + Intronic
1129073824 15:72974522-72974544 TTTTTACAATAATGCTTTATAGG + Intergenic
1129497257 15:75996019-75996041 TTGTAATCAGAATATTTTAATGG - Intronic
1129596804 15:76971396-76971418 TTTTGGCAAGAATACTTCATAGG - Intergenic
1129793203 15:78355934-78355956 TTTTGGCAAGAATACTTCATAGG + Intergenic
1129816578 15:78560284-78560306 TTTTAACAAGAATGTTTTGTAGG + Intergenic
1129861291 15:78864516-78864538 TTTTGACAAGATTATTTTAAAGG - Intronic
1131045309 15:89310268-89310290 TTTTGATAAGAAAATTTCATTGG - Intronic
1131417208 15:92270665-92270687 TTATAACAAAAATATTTTCTAGG + Intergenic
1131518664 15:93097075-93097097 ATTTAACAAAAATATTTCAAAGG - Intergenic
1131554954 15:93389326-93389348 TTTTAAAGAAAATATTTTTTAGG + Intergenic
1131653317 15:94426725-94426747 TTTTTACTAGAACATTTTAAAGG + Intronic
1131772504 15:95754159-95754181 TTCTAAGAGGAAAATTTTATTGG - Intergenic
1131798510 15:96045560-96045582 TTTGAAAAACAATATTTTAATGG + Intergenic
1131853354 15:96565951-96565973 TTTTAATAAGGATAATCTATGGG + Intergenic
1131903591 15:97116494-97116516 TTTTGACAAAAATAGTTGATTGG - Intergenic
1132008510 15:98253111-98253133 TTGTAACAAGACCATTTTCTTGG - Intergenic
1132444897 15:101906234-101906256 TTTCAACAAATATATTGTATGGG - Intergenic
1132795350 16:1718491-1718513 TTTAAATAAAAATATTTTCTAGG + Intronic
1133456870 16:5949963-5949985 TTTTGACAAGAATGTTACATAGG + Intergenic
1133518883 16:6537263-6537285 TATGAACAGCAATATTTTATAGG + Intronic
1133748223 16:8703471-8703493 TTTTAACAGCAATAATTTTTTGG - Intronic
1134389177 16:13803269-13803291 TCTTAAAACGAATATTTTAATGG + Intergenic
1134754347 16:16652926-16652948 TTTTGGCAAGAATATTGTACAGG - Intergenic
1134812383 16:17178624-17178646 TTTTAGAAAGAAAATTTTACTGG + Intronic
1134991713 16:18706098-18706120 TTTTGGCAAGAATATTGTACAGG + Intergenic
1135723547 16:24837031-24837053 TTTTATCAATAAAGTTTTATTGG - Intergenic
1136715331 16:32277107-32277129 TGTTAAAAAGAAAATTTTCTGGG + Intergenic
1136752584 16:32652622-32652644 TGTTAAAAAGAAAATTTTCTGGG - Intergenic
1136822007 16:33327819-33327841 TGTTAAAAAGAAAATTTTCTGGG + Intergenic
1136828570 16:33384358-33384380 TGTTAAAAAGAAAATTTTCTGGG + Intergenic
1136833636 16:33483132-33483154 TGTTAAAAAGAAAATTTTCTGGG + Intergenic
1137259371 16:46811569-46811591 TTTTTACAAGACTACTTAATAGG - Intronic
1137400457 16:48149161-48149183 TTTTAAAAAGTATTTTTTCTAGG - Intronic
1137602514 16:49766103-49766125 TTCTAAAAAGAAAATTTTAATGG + Intronic
1137911905 16:52385953-52385975 TTTTAGTAAGAATATCTCATTGG - Intergenic
1137988957 16:53132086-53132108 TTTTAAAAAAAATTTTTTTTGGG + Intronic
1137999387 16:53259066-53259088 TTTTAAGAAGAAAAATTTAGGGG + Intronic
1138227006 16:55304538-55304560 TTTTAACAATCAGATCTTATGGG + Intergenic
1138470190 16:57228483-57228505 TTTTAATAAGAATTTTTTAAAGG + Intronic
1138585398 16:57966773-57966795 TTTTATAAATAAAATTTTATTGG + Intronic
1138639994 16:58377853-58377875 TTTTGGCAAGAATACTTTGTAGG + Intronic
1138856028 16:60693160-60693182 AATTAAGAAGAATATTTTAATGG + Intergenic
1138916217 16:61467833-61467855 TTTAAATAAAAATATTGTATGGG - Intergenic
1139012688 16:62651832-62651854 TTCTAACACAAATAGTTTATGGG + Intergenic
1139029992 16:62868237-62868259 ATTTGAGAAGAATATTTGATTGG + Intergenic
1139097775 16:63726423-63726445 TTTTTACAAAAATAATTTAGTGG - Intergenic
1139497410 16:67330187-67330209 TTTTCACAAGACGATTTCATAGG + Intronic
1139551742 16:67677201-67677223 TTTTAAAAAGAAAATTTTGGAGG - Intronic
1139763905 16:69210690-69210712 TTTTAAGAAATATATTTTGTAGG + Intronic
1139843343 16:69900325-69900347 TGTTAAAAAGAATTTTTTAGAGG + Intronic
1140226372 16:73080742-73080764 TTTTAAAAACATTATTTTGTAGG + Intergenic
1140709215 16:77660927-77660949 TTTTAAAAAGATAATTTTTTTGG + Intergenic
1140740866 16:77940152-77940174 TTTTAACAAGCAAATCTTAGGGG + Intronic
1140770843 16:78202606-78202628 TTTTAAAAATAAAATTTCATTGG + Intronic
1141045657 16:80714084-80714106 TTTTAACACTACTAATTTATAGG + Intronic
1202994108 16_KI270728v1_random:40715-40737 TGTTAAAAAGAAAATTTTCTGGG + Intergenic
1203011280 16_KI270728v1_random:241390-241412 TGTTAAAAAGAAAATTTTCTGGG - Intergenic
1203054723 16_KI270728v1_random:912662-912684 TGTTAAAAAGAAAATTTTCTGGG - Intergenic
1144064609 17:11613317-11613339 TTTTAAAAAAAATATGTTAAAGG + Intronic
1144491810 17:15719285-15719307 TTCTCAGAAGAAAATTTTATTGG + Exonic
1144908670 17:18659919-18659941 TTCTCAGAAGAAAATTTTATTGG - Exonic
1146083478 17:29805131-29805153 TATTAATAATAATAATTTATAGG - Intronic
1146246960 17:31294317-31294339 TTTTAATAAGAAAAGTTTAACGG - Intronic
1146757541 17:35446932-35446954 TATCAAAAAGAATATTTTACAGG - Intronic
1147799270 17:43071701-43071723 TTTTAAAAATAAAAGTTTATGGG + Intronic
1148034632 17:44649954-44649976 TTGTAACAAAAATAAATTATGGG - Intergenic
1148411831 17:47474036-47474058 TTTTAAAAAAATTCTTTTATAGG - Intergenic
1148551590 17:48553638-48553660 TTTTAACAATATTATTCTCTAGG + Exonic
1149047833 17:52268332-52268354 TTTTACCAAGTATTTTTCATAGG + Intergenic
1149249709 17:54754435-54754457 TTTTAATAAATATATTTTTTTGG - Intergenic
1149272018 17:54989871-54989893 ATTTAGAAAGAATATTTTCTTGG - Intronic
1149757995 17:59203983-59204005 TTATAACAATAATATTTTATGGG + Intronic
1150519465 17:65851307-65851329 TTTTTAGAAGTATATATTATTGG - Intronic
1152219806 17:79057156-79057178 TAATAATAAGAATACTTTATTGG + Intergenic
1153593172 18:6696216-6696238 TTTTTACAAGAATACTTCAAAGG + Intergenic
1153686998 18:7556377-7556399 TTTAAACAAAAATATTTGCTTGG - Intergenic
1153989875 18:10386801-10386823 TTTTGAAAAGAATATTTAAATGG - Intergenic
1154072503 18:11165315-11165337 TTTTATCAATAAAGTTTTATTGG + Intergenic
1154158605 18:11963000-11963022 TTTAAACAAAAATATTGTTTTGG - Intergenic
1154233850 18:12583970-12583992 TTTTAATAAGCATGTTTTACTGG - Intronic
1154365450 18:13703942-13703964 TTTTAAAAAAGAGATTTTATAGG + Intronic
1155397729 18:25403950-25403972 TTTTAAAAAGATTATATTACAGG - Intergenic
1155781003 18:29835951-29835973 CTTTAAAAAGAATATATAATAGG + Intergenic
1155820773 18:30372627-30372649 TTTTAAAAAGATCATTTTATTGG + Intergenic
1156056591 18:33012593-33012615 TGTTAAGAAAAATATTTTAGGGG - Intronic
1156086194 18:33406660-33406682 TCTTAACCAAAATATTTCATAGG + Intronic
1156130712 18:33970365-33970387 TTTTTTCAACCATATTTTATGGG - Intronic
1156146178 18:34182515-34182537 TTTTAAAGTGTATATTTTATTGG - Intronic
1156256416 18:35401755-35401777 TTTGAATAAAAGTATTTTATAGG - Intergenic
1156557833 18:38087504-38087526 TTTTGACTGAAATATTTTATAGG - Intergenic
1156711636 18:39954117-39954139 TTTTAGCAAGATAATTTTCTGGG + Intergenic
1156974071 18:43195484-43195506 TTCTAACAACAGTATGTTATGGG + Intergenic
1157294746 18:46434367-46434389 TTTTCATAAAAATATATTATTGG - Intronic
1157593415 18:48849506-48849528 TTTTAAAAACCATTTTTTATTGG + Intronic
1157784832 18:50472429-50472451 TTTTGACAAGAAAATTGTATTGG - Intergenic
1157941869 18:51937842-51937864 TTTTCCCAAGACTATTTTAAGGG - Intergenic
1158053089 18:53247355-53247377 TTTTAAATACAACATTTTATGGG - Intronic
1158376187 18:56871041-56871063 ATTTTAGAAGAATATTTTACTGG + Intronic
1158660465 18:59382613-59382635 TTTTGGCAAGAATAGTTCATAGG + Intergenic
1158752339 18:60277106-60277128 TATTTACAAGAATAGTTAATTGG + Intergenic
1158774354 18:60558446-60558468 TTTTTACAAGAAAGTTTTCTAGG - Intergenic
1159009962 18:63049620-63049642 TTTTATCAAAAATAGTCTATTGG - Intergenic
1159150378 18:64515493-64515515 TTAGATCAAGAATATTTTACAGG + Intergenic
1159414892 18:68132905-68132927 TTATAACATGAATACCTTATGGG - Intergenic
1159529840 18:69641317-69641339 TGTTTACAAAAATATTTCATGGG + Intronic
1159867286 18:73721122-73721144 TTTTAAACAGAATATTTTCATGG - Intergenic
1160162918 18:76488975-76488997 TTTAAACAAGCATATTATACAGG + Intronic
1160269491 18:77371669-77371691 TTTTAACATTATTATATTATAGG - Intergenic
1160640466 19:128569-128591 TTTCAACAAATATATTGTATGGG + Intergenic
1161119268 19:2516522-2516544 TTTTTAAAAAAATATTTTTTAGG - Intronic
1163357016 19:16820068-16820090 TTTTGACAAGTATACTTCATAGG + Intergenic
1163953017 19:20608438-20608460 TCTGAACAAGTTTATTTTATAGG - Intronic
1164014751 19:21243678-21243700 TTTTAAAAAGATTGTTTTCTTGG - Intronic
1164186706 19:22875962-22875984 TTTTAAAAAGAATATTTTTGAGG + Intergenic
1164734970 19:30534531-30534553 TTTTGAAAAAAATATTTAATAGG + Intronic
1164985452 19:32645111-32645133 TTTTTAAAAAAATAATTTATTGG + Intronic
1165020915 19:32923325-32923347 TCTTAACTAAAATATTTTACGGG - Intronic
1165616039 19:37201489-37201511 TCTTAGCAATAAGATTTTATTGG - Intronic
1165664478 19:37615547-37615569 TTTTAGCAAGAATACTTCATAGG + Intronic
1166019982 19:40018364-40018386 TTTTGGCAAGAATACTTAATGGG + Intergenic
1166138830 19:40794534-40794556 ATATAATAAGAATATTCTATTGG - Intronic
1168635413 19:57992359-57992381 TTTTGATAAGAATACTTCATAGG - Intronic
925248264 2:2404114-2404136 TATTAACAACAATATATTGTTGG - Intergenic
925958231 2:8990518-8990540 TTTTTAAATGAATATTTCATTGG - Intronic
926372037 2:12188466-12188488 TTTTAAAAATAAAGTTTTATTGG - Intergenic
926523987 2:13953126-13953148 TGAGAACAAGAATATTTTCTTGG - Intergenic
926608898 2:14925477-14925499 TTTTTATGAGCATATTTTATGGG - Intergenic
926952466 2:18258177-18258199 TTTTAACATTCATATTTTAATGG + Intronic
926992142 2:18691278-18691300 TTTTACAAAGGATATTTTAAAGG - Intergenic
927470417 2:23371805-23371827 TTTTATCAAGTCTATATTATAGG - Intergenic
927611300 2:24543991-24544013 TTCTAACAAGAAATTTTTCTAGG + Intronic
927613954 2:24570679-24570701 TTTTGGCAAGAATACTTCATGGG - Intronic
927763888 2:25785922-25785944 TTTTAACAGGGACATTATATGGG + Intronic
927767585 2:25826613-25826635 TTTTGACAACTGTATTTTATAGG - Intronic
927769867 2:25850523-25850545 TTTTAGCAAGAAAACTTCATAGG + Intronic
928067548 2:28181776-28181798 TTTTAAAAAAAAAATTTTATTGG - Intronic
928652224 2:33415271-33415293 TTAAAAAAACAATATTTTATCGG - Intergenic
928739609 2:34334998-34335020 TTTTATCCAGAATAATTTCTTGG - Intergenic
928848432 2:35709777-35709799 TTTAAAAAACAATATTTAATAGG + Intergenic
929201636 2:39243450-39243472 TTTAAACAAAATTACTTTATCGG - Intergenic
929206254 2:39297428-39297450 TTTTAAAAATAGTATTTTGTTGG + Intronic
929403531 2:41613155-41613177 TTTTATCAATAAAGTTTTATTGG - Intergenic
929425866 2:41843959-41843981 TTGTAACATGACAATTTTATAGG - Intergenic
929426815 2:41852166-41852188 TTTTATCAAGAATGCTTTATTGG - Intergenic
929485354 2:42348458-42348480 TTTTGTCAGGAATTTTTTATAGG - Intronic
930181999 2:48369573-48369595 TTTTAGTAAGTATATTTTATAGG + Intronic
930223824 2:48771686-48771708 TTTAAAGAAAAATATTTTAGTGG + Intronic
930275543 2:49306493-49306515 TCTTAACCAAAATATTTTAGAGG - Intergenic
930328317 2:49949102-49949124 TTTGAACACCAATATTTTGTAGG + Intronic
930832310 2:55757936-55757958 TTTTAAAAAGGCAATTTTATTGG + Intergenic
930889840 2:56372038-56372060 TTTAAACAACTTTATTTTATGGG - Intronic
931018584 2:58015708-58015730 ATTTGACAAGAATTTTTTTTTGG + Intronic
931737301 2:65208062-65208084 TTTTGGCAGGAATACTTTATAGG + Intergenic
931772028 2:65505610-65505632 TTTTGGCAAGGATATTTCATAGG + Intergenic
931937672 2:67216028-67216050 CTTTAAGAATAATAGTTTATAGG - Intergenic
932376760 2:71242977-71242999 TTTTAAGAAAAATATTTAAACGG - Intergenic
932503810 2:72209373-72209395 TTTAAGAAAGAAGATTTTATTGG - Intronic
932529571 2:72514132-72514154 TTTTATAAAGATTGTTTTATTGG + Intronic
932844260 2:75119277-75119299 TCTTCACAAGAATTGTTTATAGG + Intronic
933218430 2:79658494-79658516 TTTTAGAAAAAATATTTTAATGG + Intronic
933331501 2:80898039-80898061 TTTTAAAAAGGATCTTTCATAGG - Intergenic
933429573 2:82158427-82158449 ATTTAACACAAATATTTTAATGG - Intergenic
933712412 2:85336663-85336685 TATTATCATGAATATTTTGTTGG + Intergenic
933932476 2:87167640-87167662 TTTTAGAAAGAAAATTTTATTGG + Intergenic
935228549 2:101076457-101076479 TTTTAGGAAGAATACTCTATAGG - Intronic
935475543 2:103517478-103517500 TTTTGACAAAAACATTTTAAGGG + Intergenic
935586839 2:104808277-104808299 CTTTCACAAAAATATTTTGTGGG - Intergenic
935998377 2:108799245-108799267 TTTTGGCAAGGATATTGTATAGG + Intronic
936360635 2:111797801-111797823 TTTTAGAAAGAAAATTTTATTGG - Intronic
936559186 2:113521840-113521862 TTTTAAAAATACTTTTTTATAGG + Intergenic
936635120 2:114247360-114247382 TTTTATAAAGAATATTTAAAAGG - Intergenic
936670404 2:114649678-114649700 TTTGAAAAACACTATTTTATAGG + Intronic
936717693 2:115208093-115208115 TTTTATCAAGATTATTCAATTGG - Intronic
936731151 2:115382773-115382795 TTTTAAAAAGAATAATTGAATGG - Intronic
936846840 2:116844709-116844731 TCTTACAAAGAATGTTTTATTGG - Intergenic
936880775 2:117248010-117248032 TTGTAATAAAAATATTTTGTTGG - Intergenic
937238602 2:120445945-120445967 TTTTAAAAATAAAGTTTTATTGG - Intergenic
937282077 2:120725008-120725030 TTTCAACAAGAATACTTCATAGG + Intergenic
937396964 2:121545680-121545702 TTCTGGCCAGAATATTTTATAGG + Intronic
937658419 2:124403249-124403271 TTTTTACAAGTATTTTCTATTGG + Intronic
937701947 2:124872778-124872800 TTTTAACAAGAGGGTATTATTGG - Intronic
937789085 2:125939198-125939220 TAGTAGCAAAAATATTTTATGGG + Intergenic
938238676 2:129726072-129726094 TATTAACATGCATATTTCATGGG - Intergenic
938424828 2:131177379-131177401 TTATAAAAAGAATACTTTCTTGG - Intronic
938517412 2:132027936-132027958 TTTAAAAAAGAATATATTTTAGG + Intergenic
939145715 2:138412358-138412380 TTGTTACAAAAATCTTTTATTGG + Intergenic
939282245 2:140079083-140079105 TTTTTAAATGAATACTTTATGGG + Intergenic
939356240 2:141106780-141106802 TTTGAAAAAGAAAGTTTTATTGG - Intronic
939436111 2:142180493-142180515 TTACAGCAATAATATTTTATAGG - Intergenic
939437139 2:142192267-142192289 TTTTTACATTAATGTTTTATGGG - Intergenic
939472398 2:142640252-142640274 TTTTATCATGTATATTTTACTGG - Intergenic
939650157 2:144750544-144750566 CTTCAACAAAAAGATTTTATGGG - Intergenic
939663433 2:144919553-144919575 ATCTAACAAGGATATTTCATTGG + Intergenic
939853474 2:147328080-147328102 TTTAAACAAGAATTTAATATAGG - Intergenic
939883967 2:147660985-147661007 TATTAAAAAGGATATTTTAAAGG + Intergenic
940031202 2:149263540-149263562 TCTTAAAAAGTATTTTTTATGGG + Intergenic
940142216 2:150504597-150504619 TTTAAATTAGAATATTTCATAGG - Intronic
940438769 2:153688128-153688150 TTTTATAAATAAAATTTTATTGG + Intergenic
940507326 2:154572868-154572890 TTTTGGCAAGAATATTTCATAGG + Intergenic
940526406 2:154820406-154820428 TTTTAACTAAAATATTTCAAAGG + Intronic
940659164 2:156524819-156524841 TTTTGTCAAAAATACTTTATGGG + Intronic
940737972 2:157474653-157474675 TCTTAACCAAAATATTTTAGAGG + Intronic
940811944 2:158253906-158253928 TTTTGGCAAGAATAATTCATGGG - Intronic
941050529 2:160727862-160727884 TGTTCAGAAGAATATTTTCTAGG - Intergenic
941109209 2:161399590-161399612 ATTTTAAAAAAATATTTTATAGG - Intronic
941163281 2:162058802-162058824 TTTTAAAAGGAAAGTTTTATGGG - Intronic
941299875 2:163787904-163787926 TATTACCAAGATTATTTTAAAGG + Intergenic
941561776 2:167055435-167055457 TTTCATCAAGGATATTATATGGG + Intronic
941585064 2:167348171-167348193 TTTTAATAATAATATTTTAAGGG - Intergenic
941719237 2:168795950-168795972 TTTTAAAAAAAATTTTTTAAGGG - Intronic
941758116 2:169210450-169210472 ATTTAGCAATAATACTTTATAGG - Intronic
941807044 2:169719887-169719909 TGATAACAAAAATTTTTTATAGG - Intronic
942193131 2:173490976-173490998 TTTTAAAGACAATAATTTATTGG - Intergenic
942298766 2:174542050-174542072 TTTTGGCAAGAACACTTTATAGG + Intergenic
942881284 2:180864154-180864176 CTTTTTCAAGCATATTTTATTGG - Intergenic
942923369 2:181404113-181404135 TTTTAAAGACAATAATTTATTGG - Intergenic
943166637 2:184335690-184335712 AATTAATAAGAATATTTTAATGG - Intergenic
943229365 2:185227415-185227437 TTTTGAGAAGAATGTTTTTTAGG + Intergenic
943294711 2:186122320-186122342 TTTTAAAAAAAATAATTTTTTGG - Intergenic
943345043 2:186728604-186728626 TTTTTAAAACAATATTTTAATGG - Intronic
943659952 2:190548632-190548654 TTTTAACAAGATTCTCTCATTGG - Intergenic
943771523 2:191722624-191722646 TATTAAGAAGGATATTTTAAAGG + Intergenic
943803037 2:192086464-192086486 TTACAACAGGAATATTTCATGGG - Intronic
943816802 2:192268270-192268292 TTTTAAAAATATCATTTTATTGG - Intergenic
943825674 2:192388232-192388254 TTTTAATAAGCAATTTTTATAGG + Intergenic
943995359 2:194757693-194757715 CTATAACATTAATATTTTATAGG - Intergenic
944022367 2:195122050-195122072 TTTTAACAAAAATCTGTTTTTGG + Intergenic
944072144 2:195683535-195683557 TTTTAATAAGAATTTGTAATAGG - Intronic
944372520 2:199001734-199001756 TTTCAATAAAAATATTTAATTGG - Intergenic
944426338 2:199587218-199587240 TTTTAAAAAGTATCTTTCATTGG + Intergenic
944735878 2:202564205-202564227 TATGGACATGAATATTTTATTGG + Exonic
944949804 2:204735341-204735363 TATGAACAAGAACATTTCATGGG - Intronic
944978310 2:205084372-205084394 TTTCAGCAAGAATATTTCATAGG + Intronic
945405066 2:209436447-209436469 TTTTAGTAATAAAATTTTATTGG - Intronic
945787291 2:214257733-214257755 ATTTAACAATAATATTTTCAAGG + Intronic
945923619 2:215781376-215781398 TCTGAACAAGAAAATTTTCTAGG + Intergenic
946633532 2:221698502-221698524 TTTAAATAAAAATATTTTGTTGG + Intergenic
947018305 2:225646043-225646065 TTATAATTAGAATATTTTCTAGG + Intronic
947131189 2:226926593-226926615 TTTTAGCAAGAAAATGTCATAGG + Intronic
947207810 2:227678184-227678206 TTTTAACAAGGATATTCCATTGG - Intergenic
947231809 2:227894961-227894983 TTTTCACACTCATATTTTATTGG - Intronic
947333245 2:229052382-229052404 TTTAAAACAGAATATTTAATTGG - Intronic
947413996 2:229874258-229874280 TTTTAAAAAGAAAAGTTTGTGGG - Intronic
948296188 2:236862460-236862482 TTTTAACAACACTATCTAATTGG + Intergenic
1169587746 20:7105133-7105155 TTTTAAAAATAATGTTCTATTGG - Intergenic
1169646556 20:7816892-7816914 TTTTAAAAATAAAAGTTTATAGG - Intergenic
1169696239 20:8390008-8390030 TTTTGACAAGCATATTTTGTAGG - Intronic
1169706123 20:8506852-8506874 TTTTAATAAAAATATTACATAGG + Intronic
1169741733 20:8902210-8902232 TTTAAAAAATAATATTTTAAAGG - Intronic
1169763148 20:9119110-9119132 TTTTATTAAGTACATTTTATGGG + Intronic
1169872289 20:10260819-10260841 TGTTAGCAATAATTTTTTATTGG - Intronic
1170218739 20:13918884-13918906 TTTTAAAAACAATAGTTTATGGG + Intronic
1170294933 20:14813585-14813607 TCTTTACAAGGATATTTTAAAGG + Intronic
1170433497 20:16298724-16298746 TTTTTGCAAGAACACTTTATAGG - Intronic
1170643643 20:18177661-18177683 TTTTAACAAAGTTATTTTCTAGG + Intronic
1170667223 20:18397137-18397159 TTTTATAAATAAAATTTTATTGG - Intronic
1170979990 20:21203376-21203398 TTTTAGCAAGAAAATGTCATGGG + Intronic
1171095024 20:22324664-22324686 TTGGAACAAGATTATGTTATGGG + Intergenic
1171247886 20:23627930-23627952 TTTTAAAAAGAATTTTTAATTGG + Exonic
1171984885 20:31653000-31653022 TTTTGGCAAGAATATTTTATGGG + Intergenic
1172724861 20:37031279-37031301 TTGTAAATAGTATATTTTATAGG + Intronic
1172877325 20:38173060-38173082 TATTAACAAAAGTATTTTAGGGG - Intergenic
1172920341 20:38475915-38475937 CCTTATAAAGAATATTTTATGGG - Intronic
1173078994 20:39848264-39848286 TATTATCAAAAATATTTAATAGG + Intergenic
1173206286 20:40996887-40996909 TTTTAGCAAGAATGCTTCATAGG - Intergenic
1173355636 20:42286389-42286411 TTTTAAAAATATTATTTCATTGG - Intronic
1173514587 20:43656413-43656435 TTTTGGCAAGAATATTTCATAGG + Intergenic
1174312016 20:49664171-49664193 GATTAGCAAGAATATTATATAGG - Intronic
1174439328 20:50536969-50536991 TTTTAACTAAAATATATGATTGG - Intronic
1174470606 20:50757677-50757699 TTTTATCAGGAATATTACATAGG + Intergenic
1174899648 20:54485029-54485051 TTTTAAAAAGAATATTATGTAGG + Intronic
1175054159 20:56183017-56183039 TTTTGGCAAGAATATTTGGTAGG - Intergenic
1176340870 21:5694351-5694373 TTTTAAAAATAATAAATTATAGG - Intergenic
1176473124 21:7126504-7126526 TTTTAAAAATAATAAATTATAGG - Intergenic
1176503957 21:7630105-7630127 TTTTAAAAATAATAAATTATAGG + Intergenic
1176695813 21:9976916-9976938 TTTTATAAATAAAATTTTATAGG + Intergenic
1176963925 21:15190530-15190552 ATTTAAAAATTATATTTTATTGG + Intergenic
1177030200 21:15973143-15973165 GTTAAATAAGAATATTATATAGG - Intergenic
1177078475 21:16608488-16608510 TTTTATAAATAACATTTTATTGG - Intergenic
1177091475 21:16774494-16774516 TTTTGCCAAGAATAATTTGTTGG - Intergenic
1177170160 21:17646131-17646153 TTTTAAACAAAATATTTTAAAGG + Intergenic
1177229898 21:18305761-18305783 TTTTAACATTAATACTTAATAGG - Intronic
1177253448 21:18627548-18627570 TTTTAAAAAGTATAATTGATAGG - Intergenic
1177264155 21:18762519-18762541 TTTTAACAAGAGTTTCTGATGGG + Intergenic
1177358145 21:20034990-20035012 TTTTAAAAGGAATTTTTTAATGG + Intergenic
1177560592 21:22746084-22746106 TTTTTATAAGAATATTGAATGGG - Intergenic
1177564863 21:22807260-22807282 TTTTAAAAATAAAGTTTTATTGG + Intergenic
1177572562 21:22905792-22905814 TTATAACAAGATTATTTGTTTGG + Intergenic
1177652599 21:23977960-23977982 TTTGACCAAGAATTTTTTTTTGG - Intergenic
1177788861 21:25700060-25700082 TTTCAATAAGAATATTTTACTGG - Intronic
1177814230 21:25958574-25958596 TGTTAACATGAATAATTAATTGG - Intronic
1178063943 21:28882826-28882848 TTTGAACATGAATAATTTTTAGG + Intronic
1178086820 21:29120582-29120604 TTAAAACCAGAATATTTCATGGG + Intronic
1178150071 21:29784086-29784108 TTTTAAAAATAGTATATTATAGG + Intronic
1178183535 21:30192532-30192554 CTTTAAAAAGAGTTTTTTATGGG - Intergenic
1178251282 21:31005733-31005755 ATGTAACAAAAATATTTTAGGGG + Intergenic
1178266164 21:31144322-31144344 TTTGGACGAGAATATTTTGTTGG - Intronic
1178484139 21:33006371-33006393 TTTATACAAGAAAATTTTATTGG + Intergenic
1178638741 21:34328777-34328799 TTTTTAGAACAATATTTAATAGG - Intergenic
1178688426 21:34730295-34730317 TATTAATAAGAACATTTTCTGGG + Intergenic
1179774281 21:43650503-43650525 TTTTATAAATAAAATTTTATGGG - Intronic
1180033991 21:45233372-45233394 TTTTATCAAAAATATTAAATTGG + Intergenic
1182140757 22:27955880-27955902 ATTAAACACAAATATTTTATGGG + Intergenic
1182476127 22:30577303-30577325 CTTTAACAACATTATTTCATGGG + Intronic
1182738660 22:32549564-32549586 TTTTATCAAGAATTTTTTTGTGG + Intronic
1183792645 22:40085647-40085669 TTTTGGCAAGAATATTTTATAGG + Intronic
1183809309 22:40240547-40240569 TTGTGCCAAGAATAGTTTATAGG - Intronic
1183851305 22:40590816-40590838 TTTTAAAGGGAATAATTTATTGG - Intronic
1183879620 22:40816378-40816400 TTTTGAAAACAGTATTTTATTGG + Intronic
1184061771 22:42087500-42087522 TTTTTAAAAAATTATTTTATGGG + Intronic
1184316843 22:43700044-43700066 TTTTAACAGATTTATTTTATAGG + Intronic
1184898432 22:47426244-47426266 TATTTAGAACAATATTTTATTGG - Intergenic
1203240135 22_KI270733v1_random:8809-8831 TTTTAAAAATAATAAATTATAGG - Intergenic
949090342 3:19955-19977 TTTTACAGAGAAAATTTTATAGG + Intergenic
949135998 3:566399-566421 TTTTAAAAATTGTATTTTATTGG + Intergenic
949645304 3:6086645-6086667 TTTTATAAATAAAATTTTATTGG + Intergenic
949649239 3:6136117-6136139 TTTTGGCAAGAATACTTCATAGG + Intergenic
949844481 3:8356048-8356070 TTTTATAAATAAAATTTTATTGG + Intergenic
949890062 3:8727128-8727150 ATTTTATAAGAATATTATATTGG + Intronic
950068397 3:10132201-10132223 TTTTAAAAAAATAATTTTATTGG + Intergenic
950176293 3:10877113-10877135 TTTTATAAATAATGTTTTATTGG + Intronic
950348795 3:12325929-12325951 TTTTATAAAGAAAATATTATTGG - Intronic
950954789 3:17040663-17040685 CTTTAATAAGCTTATTTTATGGG + Intronic
951061614 3:18214275-18214297 TTTTCACATGAATATGTCATGGG + Intronic
951169874 3:19528678-19528700 TTTTACCATAAATATTTTAGGGG - Intronic
951703422 3:25520029-25520051 TTTTATCAATAAAATTTTACTGG + Intronic
951785957 3:26419339-26419361 TACTAAGAAGCATATTTTATTGG + Intergenic
951904101 3:27687260-27687282 TTTTTAAAATAAAATTTTATTGG - Intergenic
951906255 3:27710870-27710892 TTTTAGTAATAATATTTTATAGG - Intergenic
951933025 3:27991112-27991134 TTTGAACAAGATTCTTTTGTTGG + Intergenic
952590556 3:34948485-34948507 ATTTAACCTGAATCTTTTATTGG + Intergenic
952620300 3:35330170-35330192 TTTTTTCCAGAATAATTTATTGG - Intergenic
952648808 3:35697130-35697152 TTTTAACATGAAAATTATCTGGG - Intronic
952771086 3:37001296-37001318 TTTTGACAAGAAAACTTCATAGG - Intronic
952894219 3:38066053-38066075 TTTTGACAAGAATACTTCCTTGG + Intronic
953341315 3:42136335-42136357 TTTTAAAAATAATATTTTTGTGG + Intronic
953427832 3:42810148-42810170 TTTAAAAAATAACATTTTATTGG + Intronic
953602045 3:44376348-44376370 TTTTAATAAATATATTTTTTAGG - Intronic
953609865 3:44438594-44438616 TTTTAAAAAAATTATTTTTTTGG - Intergenic
955125638 3:56108675-56108697 TTTTAAAAAGAATCATCTATAGG - Intronic
955261326 3:57393771-57393793 TTTTAATAAAACTATCTTATGGG - Intronic
955292391 3:57704599-57704621 TTTTAAAAAAAATTTTTTAGAGG + Intergenic
955590352 3:60528137-60528159 TTTCTACAAGAAAAGTTTATTGG - Intronic
955606005 3:60704787-60704809 TTTTAACAACATTATTTTTTAGG - Intronic
955610601 3:60752710-60752732 TTTTGAGAAACATATTTTATAGG - Intronic
955994569 3:64666849-64666871 TTTTAGAAAGAATCTTTGATGGG + Intronic
956080914 3:65555185-65555207 TTTCAACAAAAGTATTTTAAAGG + Intronic
956124710 3:66000414-66000436 TTTCAATAAGAAAATTTAATTGG - Intronic
956339993 3:68211800-68211822 TTTTAACAACCACCTTTTATGGG + Intronic
956404170 3:68910738-68910760 TGTACACAAAAATATTTTATGGG + Intronic
956429171 3:69167068-69167090 TTTTAACAAGTATATTCAGTAGG + Intergenic
956463762 3:69498340-69498362 TTATGACAAGAATATTTGTTAGG + Intronic
956924222 3:73966036-73966058 TTTTAAAAATATAATTTTATGGG + Intergenic
957297247 3:78348515-78348537 TTATAACAAAATTATTTTAGAGG - Intergenic
957341996 3:78911993-78912015 ATTTAACAAAAATATTTTGATGG + Intronic
957383977 3:79471594-79471616 TTTTAAAAATAATTTTTTATAGG - Intronic
957970656 3:87377594-87377616 ATTTAAAATGAAAATTTTATTGG + Intergenic
958050889 3:88344251-88344273 TTCTAAAAAGAAAATTTTGTTGG - Intergenic
958137941 3:89520516-89520538 TATTACAAAGAATATTTTAAAGG - Intergenic
958185476 3:90114112-90114134 CTTTAACAATATTATTTTGTAGG - Intergenic
958436394 3:94101419-94101441 TTTTAACATGAAAAACTTATTGG + Intronic
958475831 3:94580544-94580566 TTCTAACAAGAAATGTTTATTGG - Intergenic
958491127 3:94775120-94775142 TTTTTACAATAATATTTTGGTGG - Intergenic
958753183 3:98217353-98217375 TGTCAAGAAGAATATTTTCTAGG - Intergenic
958891407 3:99787385-99787407 TTTTAACAAGTGCATTTTAATGG + Intronic
959187076 3:103057904-103057926 TTTTAAAAAGAATATATTGGTGG - Intergenic
959206407 3:103312511-103312533 TCTTAAAAATAATATTGTATAGG + Intergenic
959298034 3:104562601-104562623 TTGTAACACAAAAATTTTATGGG - Intergenic
960350070 3:116581739-116581761 TTTTAACAAGGATACTTTTAAGG - Intronic
960744506 3:120872336-120872358 TTTTTAAAAAAATGTTTTATAGG + Intergenic
960833993 3:121884807-121884829 ATTTAAGAAGAATAGTTTTTAGG - Intronic
960918630 3:122723607-122723629 TTTTTGCAAGAATACTTCATAGG + Intronic
961240787 3:125409359-125409381 TTTTGGCAAGACTACTTTATAGG + Intergenic
961760622 3:129164729-129164751 TTTAGACAAGAATATATCATAGG - Intergenic
961953874 3:130780034-130780056 TTTTAGCAAGACTATTTCACAGG - Intergenic
962696848 3:137957752-137957774 TTTTGGCTAGAATATTTCATAGG + Intergenic
962973795 3:140428703-140428725 TTTTAAATAGGATATCTTATTGG - Intronic
963337559 3:143994147-143994169 TTTTGATAAGAATATTTAGTAGG + Intronic
963705408 3:148680918-148680940 TTTTGAGAAGCAAATTTTATGGG - Intergenic
963765082 3:149326334-149326356 TTTTAGCGAGAATACTTAATGGG + Intronic
963933541 3:151028778-151028800 TTGTAATAACATTATTTTATAGG - Intergenic
964082714 3:152779159-152779181 TTTTGACTAGAAAATTATATAGG - Intergenic
964142072 3:153414724-153414746 TTTGAAGAGGAAAATTTTATGGG + Intergenic
964215844 3:154281023-154281045 TTTTGTCAATAACATTTTATTGG + Intronic
964235053 3:154515837-154515859 TTTTTAAATGAATATTTTAGTGG + Intergenic
964301370 3:155289066-155289088 TTTTGGCAAGAATACTTCATAGG + Intergenic
964714721 3:159709846-159709868 TTGTTACAAGAAGATTTAATAGG + Intronic
965041571 3:163514897-163514919 TTATCACAAAAATATTTTCTTGG - Intergenic
965047915 3:163602970-163602992 TTTTAACCAGTATATGTTCTTGG - Intergenic
965087281 3:164114764-164114786 TTTTAACAAGAATATTGCTTTGG + Intergenic
965169807 3:165248447-165248469 TTTTAACAAAAATATAATTTTGG - Intergenic
965203785 3:165694077-165694099 TTTTAATGATAATATTTTAGTGG - Intergenic
965792302 3:172402811-172402833 TGTTAACAAGAAAATGTTCTTGG + Intergenic
965825031 3:172721579-172721601 TTTTCATAAGAATTGTTTATGGG + Intergenic
965891646 3:173521397-173521419 TTTTAACAAGTAAAGTTTGTAGG - Intronic
965901007 3:173641815-173641837 TTTTGTAAATAATATTTTATTGG + Intronic
965976276 3:174627217-174627239 TCTTTACAAGAATATTATTTAGG - Intronic
965999769 3:174933616-174933638 TTTTAACTGAACTATTTTATTGG - Intronic
966014603 3:175126137-175126159 TTGCAACAAGAATAGTTTCTGGG + Intronic
966033922 3:175386436-175386458 TTTTGACAAGAATATTTCATAGG + Intronic
966054913 3:175675078-175675100 GTTTATTGAGAATATTTTATCGG + Intronic
966133445 3:176671147-176671169 TTCTAATGAGTATATTTTATTGG + Intergenic
966544718 3:181132899-181132921 TTTTAAAAATAAAATTTTCTAGG - Intergenic
966735841 3:183186422-183186444 TTTTAAAAAAAATTTTTTGTAGG + Intronic
967550403 3:190787868-190787890 TTTTAATGAGAATAGTTTCTAGG + Intergenic
967572749 3:191050132-191050154 GTGTGACAAGGATATTTTATAGG + Intergenic
967996001 3:195167181-195167203 TTGTAACAACAACATTTTGTGGG + Intronic
968018711 3:195364208-195364230 TTATAACAAGAATATTATAAAGG + Intronic
968163008 3:196442544-196442566 TTTTGCCAAGAATATGTCATAGG - Intergenic
968854126 4:3106068-3106090 TTTCAATAAGAATCTTATATGGG + Intronic
969554068 4:7894203-7894225 TTTTGTCAATAATGTTTTATCGG + Intronic
969762264 4:9196801-9196823 TTTTAAAAATCATATTTAATAGG + Intergenic
970417083 4:15869474-15869496 TTCTAACGAGAATGTTTTAAGGG - Intergenic
970712629 4:18881250-18881272 CATTAATAAGAATAATTTATAGG + Intergenic
970845191 4:20529240-20529262 TTTGTACAAGAATATATTAGAGG + Intronic
971135745 4:23866375-23866397 TTATAAAAAGAGGATTTTATAGG - Intronic
971249388 4:24960574-24960596 TGTTAACAATAATTTTTTAAAGG + Intronic
971279230 4:25227698-25227720 TTTAACAAAAAATATTTTATTGG + Intronic
971488377 4:27185721-27185743 ATTTCACAAGTAGATTTTATGGG - Intergenic
971609416 4:28703314-28703336 TGTTAAGAAAAATACTTTATGGG + Intergenic
971817616 4:31509036-31509058 CTTTATAAAGAATATCTTATAGG + Intergenic
972027252 4:34398482-34398504 TTTTTATAACTATATTTTATTGG - Intergenic
972087106 4:35232263-35232285 TTTTCTCAAGTATATTTTTTTGG + Intergenic
972218259 4:36921569-36921591 TTGTAATAAGAACAATTTATTGG - Intergenic
972355454 4:38276181-38276203 TTTTATAAATAAAATTTTATTGG + Intergenic
972363132 4:38347352-38347374 TTTTGGCAAGAATACTTTCTAGG + Intergenic
972926611 4:44016298-44016320 TTTTAACAAAAAAATGTTAACGG + Intergenic
973062517 4:45745502-45745524 TTAAAAAAAGAATATTTTATCGG - Intergenic
973160815 4:47014008-47014030 TTTTAATTATAAAATTTTATAGG + Intronic
973267023 4:48221080-48221102 TTATTACAAGGATATTTTAAAGG + Intronic
973719872 4:53712295-53712317 ATTTAACAACAACTTTTTATAGG - Intronic
973887096 4:55334323-55334345 TTTTATCCAGAATATATTATTGG + Intergenic
973997213 4:56470726-56470748 TTTTAGCAAACATATTTAATAGG - Intronic
974239424 4:59226714-59226736 TTTTAACTAGTATATTCTTTTGG + Intergenic
974286206 4:59870851-59870873 TTATAACAAAATGATTTTATGGG - Intergenic
974452223 4:62080189-62080211 TAGTAACAAGAATATTTTGAGGG - Intergenic
974460513 4:62181423-62181445 TTATAAGAAAAATAATTTATTGG + Intergenic
974462992 4:62213395-62213417 TTTTAATAAAAATATTTATTTGG + Intergenic
974491032 4:62565328-62565350 TTCTAACAAAAGTATTTTAGGGG - Intergenic
974532879 4:63133702-63133724 TTTAAAAAAGAAAATTTTGTGGG - Intergenic
974586615 4:63887969-63887991 TTTTAGCATGTGTATTTTATAGG - Intergenic
974738132 4:65967355-65967377 TTTTAAAACAAATATTTTAGTGG - Intergenic
974779775 4:66538992-66539014 TCATGACATGAATATTTTATAGG - Intergenic
974943641 4:68499622-68499644 TTTTAACTAGCACATTTTGTTGG - Intergenic
975089374 4:70383281-70383303 TTTCAACGATAACATTTTATGGG + Intronic
975218449 4:71784814-71784836 TTACAACTAGTATATTTTATGGG + Intronic
975438967 4:74388277-74388299 TATGAACAAGAATTTTTTAACGG - Exonic
975537396 4:75465715-75465737 TTTTAAAAAGTATATTTTTATGG - Intergenic
975604723 4:76143119-76143141 TGTTTGCAAGACTATTTTATAGG - Intronic
975915819 4:79324610-79324632 TTTTGGAAAGAATATTTCATAGG + Intronic
975916104 4:79326963-79326985 TTTTATCAAAAATATATTCTGGG + Intergenic
976010522 4:80482346-80482368 TTCCAAAAAGAATACTTTATGGG - Intronic
976086945 4:81416475-81416497 TTTTATCAAGTATATCTCATTGG - Intergenic
976258273 4:83121262-83121284 TTTTGGCAAGAATACTTCATAGG + Intronic
976425853 4:84902380-84902402 TTTTAAAAAAACTATTTTATTGG - Intronic
976435892 4:85017815-85017837 TTTTAGCAAGAATTTGTTATAGG + Intergenic
976575106 4:86660402-86660424 TTTTAAAAAAAAGACTTTATAGG + Intronic
976645718 4:87385613-87385635 TTTTTAAAAGTATATTGTATTGG + Intronic
976697148 4:87929072-87929094 TTTTAAAAAGTAAATTTTAAAGG + Intergenic
976784735 4:88805444-88805466 TCTTAACAGGAATGTTTTGTTGG - Intronic
977007015 4:91580404-91580426 TTCTAACAATAATTTTTTTTTGG + Intronic
977222043 4:94349570-94349592 TTTTAAAAAGCATATTTTCCAGG - Intergenic
977248689 4:94664288-94664310 TTTTATAAAGCTTATTTTATGGG - Exonic
977310180 4:95376590-95376612 TCATAATAAAAATATTTTATAGG - Intronic
977322964 4:95542858-95542880 TTTTAATAAAAACATTTTATAGG - Intronic
977412243 4:96682792-96682814 TTTTTTCTAGAATATTTAATAGG + Intergenic
977415113 4:96722496-96722518 TTTTAAAAAGAAGATTTCACGGG - Intergenic
977967839 4:103175424-103175446 CTTTATCAATAATACTTTATAGG + Intronic
977978099 4:103290648-103290670 TTGTAAAAATAACATTTTATTGG - Intergenic
978462191 4:108968452-108968474 TTTTATTCAGAATATTATATTGG + Intronic
978767674 4:112421130-112421152 TTTCATAAAAAATATTTTATGGG - Intronic
978827762 4:113045252-113045274 TTTTGTTAAGCATATTTTATAGG - Intronic
979011686 4:115378433-115378455 TTTTAACAAGAATATTGCCATGG - Intergenic
979143897 4:117216146-117216168 TTTTATCAAAAATATAATATAGG + Intergenic
979312082 4:119214553-119214575 TTTTAAAAAAGATATTTTAATGG + Intronic
979486229 4:121273961-121273983 TTTTTAGAATAATATTTTACAGG - Intergenic
979806663 4:124981389-124981411 TGTTGGCAAGAATATTTCATGGG + Intergenic
979831217 4:125306546-125306568 TTTTATAAATAATGTTTTATTGG + Intergenic
980020263 4:127701110-127701132 CTTCATCAAGCATATTTTATAGG - Intronic
980030798 4:127827241-127827263 TTTTAACAGAAAACTTTTATAGG - Intronic
980039481 4:127922973-127922995 TTTTGGCAAGAATACTTTATAGG - Intronic
980047625 4:128006192-128006214 CTTTAATAGGAATTTTTTATTGG - Intronic
980062953 4:128151915-128151937 TTTTGACAAGAACATTACATAGG + Intronic
980092695 4:128458835-128458857 TTTTGACAAAGATAATTTATGGG + Intergenic
980315424 4:131193383-131193405 TTTAAAAAGAAATATTTTATAGG + Intergenic
980368430 4:131837156-131837178 TTTTATAAATAAAATTTTATAGG + Intergenic
980465892 4:133180618-133180640 TTTTAACCAGAATTCTTTACTGG + Intronic
980498589 4:133617827-133617849 TTTTAAAAAAAGTATTTTATTGG + Intergenic
980590658 4:134883665-134883687 TCTCAATAAGAATATTTTACGGG + Intergenic
980664957 4:135921108-135921130 ATGTAATAAGAATATTTTCTTGG + Intergenic
980720771 4:136691871-136691893 TTTTACCAATATTATTTTATAGG - Intergenic
980748961 4:137063346-137063368 TTTTAAGAGGAATACTTTAAAGG + Intergenic
980816629 4:137955154-137955176 ATTTATCAAGAAAATTTAATAGG + Intergenic
981071316 4:140542745-140542767 TTTTAATAAGAACTTTTTAAAGG + Intronic
981467971 4:145096173-145096195 TTTTACCAAGAAAAATTTAATGG + Intronic
981659366 4:147147718-147147740 TTTTGGCAAGAATATTTCAGAGG + Intergenic
981926079 4:150140714-150140736 TTTTAAAATGAGTTTTTTATAGG + Intronic
981987200 4:150872182-150872204 TTTTAAAAAGAAAATTTTGGGGG - Intronic
981989954 4:150906702-150906724 TTTTAATAAGTATTTGTTATTGG - Intronic
982028132 4:151272773-151272795 TTTTAACAAGGATACTTCATAGG + Intronic
982242230 4:153311858-153311880 ATTTATCAAAAACATTTTATAGG - Intronic
982527509 4:156497917-156497939 TTTCAACATGAATATTTAAAGGG + Intergenic
982687765 4:158512473-158512495 TTGTAACAAGATTACTTTTTAGG + Intronic
982744280 4:159090380-159090402 TATTAACAACAATTTTTTAAAGG - Intergenic
983005733 4:162482565-162482587 GTTTATCCAAAATATTTTATTGG - Intergenic
983115187 4:163806580-163806602 CTTTATTAAGAATATTTTATTGG + Intronic
983206414 4:164914972-164914994 TTTTGGAAAGAATATTATATAGG + Intergenic
983212208 4:164970574-164970596 TTTTGGAAAGAATATTATATAGG - Intronic
983590377 4:169403571-169403593 TTTTAATAATAAAATTTTTTGGG - Intronic
983666150 4:170186569-170186591 TTTTTAAAAAAATGTTTTATAGG + Intergenic
983731273 4:170996693-170996715 TGTAAACAAGAGTGTTTTATTGG - Intergenic
983821678 4:172201535-172201557 TTTTAATAAGAATAGTTGGTTGG + Intronic
983869081 4:172803551-172803573 ATTTGACAAGAATACTTCATAGG + Intronic
984127036 4:175824125-175824147 TTTTCTCAAGGATGTTTTATTGG + Intronic
984306747 4:178001797-178001819 TTTGAGCAAGAATACTCTATAGG - Intergenic
984417105 4:179475801-179475823 TTTTGACAAAAAAAATTTATAGG - Intergenic
984456973 4:179982239-179982261 TCATTACTAGAATATTTTATAGG + Intergenic
984468450 4:180131613-180131635 TTTTAACAATATCATTTGATCGG - Intergenic
984657444 4:182334257-182334279 TTTTTTAAATAATATTTTATAGG - Intronic
984667241 4:182442023-182442045 ATTCACCAAGAATAGTTTATGGG - Intronic
985849299 5:2376832-2376854 TTTTACCCAGAATATCTTGTCGG + Intergenic
986314956 5:6580848-6580870 TTTTGTCATGACTATTTTATGGG + Intergenic
986444553 5:7810162-7810184 TTTTAAAAAGGATATTTTGCTGG + Intronic
986453368 5:7889662-7889684 TTTGAAAAAGAAAATTTTATAGG - Intronic
986530261 5:8729312-8729334 TTTTTAAAAGCATATTTTCTTGG + Intergenic
986582530 5:9280076-9280098 TTTTAACATGTATTTTTTCTTGG + Intronic
986681384 5:10236160-10236182 ATTTATCAATAATAATTTATAGG + Intronic
986882041 5:12186034-12186056 TTTTAACATGAATATTGGAGGGG - Intergenic
987023896 5:13903824-13903846 TTTTAACAAGAGTCTGTTAATGG - Intronic
987590746 5:19922929-19922951 TTTTAAAAAGGATATTTGAGAGG - Intronic
987731923 5:21784547-21784569 TTTTAAATATAACATTTTATGGG + Intronic
987931230 5:24401354-24401376 TGTTAACATAAATAATTTATAGG + Intergenic
987969047 5:24918272-24918294 TATTATGAAGAATGTTTTATAGG + Intergenic
987996433 5:25287534-25287556 TTTTATCAGGATAATTTTATTGG - Intergenic
988116211 5:26894764-26894786 CTATAACAACAATATTTTATTGG + Intronic
988137957 5:27199846-27199868 TTTTAAGAAGAATTTTTAAGAGG - Intergenic
988170385 5:27647028-27647050 TTTTAACAAAAAGATTTAAAAGG - Intergenic
988273543 5:29050024-29050046 TTTTAACAATGAAAATTTATTGG + Intergenic
988305176 5:29485468-29485490 TTTGAACTATATTATTTTATTGG + Intergenic
988356377 5:30181343-30181365 TTTTCCAAAAAATATTTTATTGG - Intergenic
988386375 5:30570886-30570908 GTTTAAAAAGATTATTTTGTTGG - Intergenic
989172962 5:38491927-38491949 ATTTATTAACAATATTTTATAGG + Intronic
989245462 5:39249419-39249441 TTTTACAAAGAATGTGTTATTGG - Intronic
989487691 5:42011175-42011197 TTTCAACATGAATTTTTAATAGG - Intergenic
989667922 5:43878188-43878210 TTTGAAAAAGGATATTTTATGGG + Intergenic
989735808 5:44703790-44703812 TTTTAACACTAATATTTATTAGG - Intergenic
989960861 5:50413383-50413405 TTTTAACAAGACTATATCCTAGG - Intronic
990012465 5:51016747-51016769 ATCCAACTAGAATATTTTATTGG + Intergenic
990033031 5:51284600-51284622 TTTTAAAAAAATTATTTTGTCGG - Intergenic
990178297 5:53131716-53131738 TTTTAATTAGAATATTTTATGGG + Intergenic
990372630 5:55136245-55136267 TTTTATTAAAAATATTTTTTGGG - Intronic
990398615 5:55412334-55412356 TTTTAAAAATAATATTTAAAAGG + Intronic
991119924 5:63000810-63000832 TTTTACCAAAAATATCTTCTGGG - Intergenic
991154225 5:63411748-63411770 TTTTCATAAAAATATGTTATGGG + Intergenic
991248240 5:64530804-64530826 TATTAAGTAGAATAATTTATTGG + Intronic
991253509 5:64589460-64589482 TTTTGGCAAGAATATTATAGGGG - Intronic
991645602 5:68797566-68797588 TATTAACAATAATTTTTTAATGG + Intergenic
992035389 5:72769634-72769656 TTTTAAAAATAATTTATTATTGG + Intergenic
992070137 5:73140789-73140811 TTTAAACAAAAATACTTTAGAGG + Intergenic
992170412 5:74095963-74095985 TTTTAAAGAGAATATTTCAGAGG + Intergenic
992283632 5:75209029-75209051 ATTGAAAAAGAATATTTTAGGGG - Intronic
992363481 5:76067099-76067121 TTTTGACAAAAACATTTTAAGGG - Intergenic
992579892 5:78162115-78162137 TTTAAACAAAATTATTTTAAAGG + Intronic
992677784 5:79123018-79123040 TTTTAAAAAGAATATTAAACAGG + Intronic
992851998 5:80819785-80819807 TTTTAATAAAAATATGTTTTTGG - Intronic
992972555 5:82077448-82077470 TTGTAATAATAATATTTTGTGGG + Intronic
993194069 5:84718334-84718356 TTTTAAAAAGATGATTCTATTGG - Intergenic
993219784 5:85077725-85077747 TTTTGGCTAGAATATTTCATTGG + Intergenic
993256938 5:85604072-85604094 CTTTAATAAGCATATTTTAATGG - Intergenic
993292501 5:86092654-86092676 TTTTTACAAATATATTTTAGGGG - Intergenic
993329946 5:86586995-86587017 TTTTATGAATAAAATTTTATTGG + Intergenic
993667375 5:90717152-90717174 TGACAACAAGAATAGTTTATTGG + Intronic
993737457 5:91495214-91495236 TTTTCTGAAGAATATTTTATGGG + Intergenic
993835935 5:92819908-92819930 TTTAAATCACAATATTTTATTGG - Intergenic
993877815 5:93328529-93328551 TTTTAAGAAAAATATTTTTCTGG - Intergenic
993939609 5:94042618-94042640 TTTTAACAAAAATTTGTAATGGG + Intronic
994111491 5:96009875-96009897 TGTCAAGAAGAGTATTTTATAGG + Intergenic
994159190 5:96536477-96536499 CTTTGACAAGAAAATTTTACTGG + Intronic
994265472 5:97710942-97710964 TTTAAAAAGGAATAGTTTATTGG + Intergenic
994568698 5:101485433-101485455 TTTTAAAATAAATATTTTAAAGG + Intergenic
994772700 5:104003313-104003335 GTTTGACAAGAATGCTTTATAGG - Intergenic
994800718 5:104370993-104371015 TTTTATAAAGAAGATATTATTGG - Intergenic
994830751 5:104779958-104779980 TTTTAATAAGAACACTTCATAGG + Intergenic
994873774 5:105388643-105388665 TTTTTACAAGGATATTTGACTGG - Intergenic
994941890 5:106334426-106334448 TTTTAAGAAGAACATGATATGGG - Intergenic
995007182 5:107213787-107213809 TTTTTAAAAAATTATTTTATTGG - Intergenic
995127997 5:108599157-108599179 TTAAAACAAGTATATTTAATGGG - Intergenic
995579719 5:113583845-113583867 TTTTAACAAGAATATTTTATAGG + Intronic
995704034 5:114967048-114967070 TTTTAACAAGATTAATTCTTTGG - Intergenic
995741744 5:115363275-115363297 TTTTGGCAAGAATATCTGATCGG + Intergenic
995757886 5:115529645-115529667 TTTTAAAAATAATATCTTGTAGG + Intronic
995992689 5:118262071-118262093 TTATAATAAAAATATTTCATGGG + Intergenic
996029410 5:118688054-118688076 TTTTAAGAAGAGTATTTCAGAGG - Intergenic
996132683 5:119801043-119801065 TTTTGACAAGAAAAATTTAAGGG - Intergenic
996238707 5:121168430-121168452 TTTTATAAACAACATTTTATTGG + Intergenic
996286822 5:121803888-121803910 TTCTAAGAACAATATTTTCTAGG + Intergenic
996353096 5:122567345-122567367 TTTTAACATGTGAATTTTATTGG - Intergenic
996593756 5:125178277-125178299 TTTTATCAATAAAGTTTTATTGG + Intergenic
996604961 5:125311163-125311185 TTTTATAAATAAAATTTTATTGG - Intergenic
996854378 5:127988642-127988664 TTTTAAGAAGAATAAAATATTGG + Intergenic
996901084 5:128542244-128542266 TTTTGACAAAGATATTTCATAGG - Intronic
996936484 5:128955230-128955252 TTTTGGCAAGAATACTTCATAGG - Intronic
996990357 5:129623095-129623117 TTTTTAGAAGTATCTTTTATAGG + Intronic
997138300 5:131350392-131350414 TTTTGACATTAATATTTTGTAGG - Intronic
997348097 5:133208482-133208504 CTTCAACTTGAATATTTTATTGG + Intronic
997706498 5:135958638-135958660 TTTTGACAAGAATACTTTATAGG - Intergenic
997749571 5:136331138-136331160 TTTTAACAAGCACATTTTCTGGG + Intronic
997764824 5:136491198-136491220 CTTTAAAAAAAAAATTTTATTGG + Intergenic
997933741 5:138092814-138092836 ATTTCTCAAGAATATTTTAGTGG - Intergenic
998008050 5:138670603-138670625 TTTTAGCAAGAACATATTTTGGG + Intronic
998389185 5:141776093-141776115 TTTTTTAAAGAATATTTTGTAGG - Intergenic
998649450 5:144101651-144101673 TTTTGAAAATAAAATTTTATAGG - Intergenic
998816911 5:146023567-146023589 TTTTGTCAAGAATACTTCATAGG + Intronic
999416260 5:151398659-151398681 TTTTAACAAGACTGAATTATTGG - Intergenic
999446146 5:151641118-151641140 TTTTAAGAATAATGTTTTATGGG + Intergenic
999635290 5:153615640-153615662 TTTTATCAACAATTTTTAATAGG - Intronic
1000086969 5:157896146-157896168 TTTTGACAAGACTATTTTGTGGG + Intergenic
1000213669 5:159134221-159134243 TCTTAACAAGAATATCTCAGAGG + Intergenic
1000693213 5:164348060-164348082 TTTTAGCACGAATATTTCACTGG + Intergenic
1000736558 5:164909391-164909413 TTTTAATAAGTATATTTAATAGG + Intergenic
1000784964 5:165531853-165531875 TTTGAATAGGAATATTTCATAGG - Intergenic
1001374948 5:171247421-171247443 TTTTAAAAAGAGGAATTTATTGG + Intronic
1001467510 5:171981316-171981338 TTTTAAAAAGAACATTATAAGGG - Intronic
1001775348 5:174325272-174325294 TTTTAATAAAAATATGTAATGGG + Intergenic
1002736885 5:181397845-181397867 TTTCAACAAATATATTGTATGGG - Intergenic
1002747815 6:76972-76994 TTTCAACAAATATATTGTATGGG + Intergenic
1003350399 6:5312255-5312277 TTTTAATAAGAATTTATTTTAGG + Intronic
1003610896 6:7614284-7614306 TATTACAAAGAATATTTTAAAGG + Intergenic
1003752185 6:9071275-9071297 TTTTAAAAAGAATACTAGATAGG - Intergenic
1003929764 6:10912857-10912879 TTTTCCCAAGAATACTCTATGGG + Exonic
1004125759 6:12871618-12871640 CTTTGCCAAGAATACTTTATGGG + Intronic
1004499251 6:16195102-16195124 TTTTTGCAAGACTATTATATAGG - Intergenic
1004719468 6:18254488-18254510 TGTTAAAAATAATATTTTCTAGG - Intronic
1004765768 6:18724612-18724634 TTTTAACAAGAATTTGTAAAGGG + Intergenic
1004817567 6:19329143-19329165 TTTTAAAATGAATATTCCATTGG + Intergenic
1005134029 6:22546121-22546143 TTTTAAAAACCATATTTTAATGG + Intergenic
1005322621 6:24669555-24669577 TTTTAAAAAAAATTTTTTTTTGG + Intronic
1005533473 6:26731836-26731858 TTTTAACAAGACAATTTGATAGG - Intergenic
1005535176 6:26747837-26747859 TTTTAAGAAGACAATTTGATAGG + Intergenic
1005537321 6:26769816-26769838 TTTTAACAAGACAATTTGATAGG + Intergenic
1005593660 6:27355142-27355164 TTTTAACAAAAAAGTTTTAAAGG + Intergenic
1005765723 6:29010020-29010042 TTTTGGCAAGAATACATTATAGG + Intergenic
1006659151 6:35624764-35624786 TGTTAGGAGGAATATTTTATAGG - Intronic
1007080237 6:39095661-39095683 TTTTATCAATAAAGTTTTATTGG + Intergenic
1008081436 6:47198925-47198947 TTTTATCAATCCTATTTTATAGG + Intergenic
1008162753 6:48098736-48098758 TCTTAACAAAAATATTTTCTTGG + Intergenic
1008208602 6:48693634-48693656 TTTTAAAAAATATATTTTAATGG - Intergenic
1008368666 6:50710141-50710163 TTGAAACAAAAATATTTTCTTGG - Intergenic
1008679731 6:53859310-53859332 TTTTAATAAGAATTCTATATAGG - Intronic
1009006200 6:57791276-57791298 TTTTAACAAGACAATTTGATAGG + Intergenic
1009008203 6:57812244-57812266 TTTTAACAAGACAATTTGATAGG + Intergenic
1009243912 6:61211029-61211051 ATTTAAAAAAAATATATTATAGG - Intergenic
1009362664 6:62834814-62834836 TATTAAGAACAATATTATATGGG - Intergenic
1009710832 6:67317221-67317243 TTTTACAAAGAATATTTCTTGGG + Intergenic
1009812281 6:68683596-68683618 TTATATGAAGAATATTTGATGGG + Intronic
1009922651 6:70082339-70082361 TTTTAACAAAGATATTTTGAAGG - Intronic
1009989983 6:70830737-70830759 TGTTAACCAAAATATTTAATTGG + Intronic
1010352488 6:74890688-74890710 TTTAAAGAAAAATATTTTATAGG + Intergenic
1010357475 6:74950965-74950987 TTAACACAAAAATATTTTATTGG + Intergenic
1010588041 6:77678924-77678946 TTTTAACAAAAATGTTTAAGAGG + Intergenic
1010735541 6:79439799-79439821 ATTTAACTAGAATATTTAACCGG + Intergenic
1010826364 6:80481570-80481592 TTTTAATAATAATTTTGTATTGG - Intergenic
1011017817 6:82777971-82777993 TTTTAAAAAGAATCTATTTTTGG + Intergenic
1011075417 6:83432469-83432491 TTTTATAGAGAATATTTTCTAGG + Intergenic
1011121553 6:83959288-83959310 TTTTGACAAGACTATTTCACAGG - Intronic
1011183440 6:84647932-84647954 TTTTATCTAAAATATATTATGGG - Intergenic
1011717304 6:90120896-90120918 TTTTCACACTCATATTTTATGGG - Intronic
1011932017 6:92725184-92725206 TATAAACAAAAATATTTTATTGG - Intergenic
1011972831 6:93249186-93249208 TTTTAAAAGGGATATTTTAGAGG - Intronic
1012009471 6:93763975-93763997 TTTTATCATTAATTTTTTATTGG + Intergenic
1012313641 6:97758460-97758482 TTTTCACAAAAATATTTTATAGG + Intergenic
1012501840 6:99896796-99896818 TTTTAACAACGCTATTTTATAGG - Intergenic
1012582488 6:100885575-100885597 TTTGAATAAGAATGTTGTATAGG + Intergenic
1012733714 6:102912553-102912575 TTTTAACAAGCATAGTCTAATGG + Intergenic
1013040635 6:106430115-106430137 TTTTAATAAAAATATTATACTGG - Intergenic
1013787837 6:113801974-113801996 TTTTGGCAAGAATACTTTAAAGG - Intergenic
1014052426 6:116970732-116970754 TTTAAGCAAGATTACTTTATAGG + Intergenic
1014163574 6:118198193-118198215 TTTTTGCAAGAATATTTTTCTGG + Intronic
1014237127 6:118970523-118970545 TTTTAACTTAAATATTTAATAGG - Intronic
1014276073 6:119390876-119390898 TTTTTAAATAAATATTTTATAGG - Intergenic
1014423994 6:121280144-121280166 TTTTAAGAAAGATATTTAATAGG - Intronic
1014452939 6:121602763-121602785 TTTTAGAAATAATATTTTATAGG + Intergenic
1014615109 6:123588742-123588764 TTTCAACATGAAAGTTTTATCGG + Intronic
1014672136 6:124318441-124318463 AATTATCAAGAATAATTTATTGG - Intronic
1014702075 6:124702132-124702154 TTTTATCATGCATATTTGATAGG - Intronic
1014820521 6:125983994-125984016 TTTTGAGAATAAAATTTTATTGG - Intergenic
1014975813 6:127881267-127881289 TTTTAACAAGTACAAATTATTGG - Intronic
1015128330 6:129780451-129780473 TTTTAACATGAACCATTTATTGG - Intergenic
1015330342 6:131971003-131971025 ATTTAACACACATATTTTATTGG + Intergenic
1015388958 6:132659681-132659703 TTCTAACTATAATATGTTATTGG - Intergenic
1015426262 6:133071567-133071589 TTTTAAAAATATTATTTAATAGG - Intergenic
1015470962 6:133605850-133605872 TGTTAACAACAGTATTTTCTAGG + Intergenic
1015706950 6:136098507-136098529 TTCTAATAAGAACACTTTATGGG + Intronic
1015778392 6:136838402-136838424 TTTCAACAAGTAAATGTTATGGG + Intronic
1015906042 6:138117873-138117895 TTGTAAAAAGTATATTTTAAGGG - Intergenic
1016126853 6:140414288-140414310 TTTTAAAAAGCATATTTATTGGG + Intergenic
1016979929 6:149844587-149844609 TTTTAAATAGAATATTAAATAGG - Intronic
1017106411 6:150892796-150892818 TTTTTACAAGAAGAATGTATGGG + Intronic
1017287734 6:152696373-152696395 CTTTAGCAAGAATATTATAGAGG + Intergenic
1017298806 6:152832731-152832753 TTTTGACAAGAACATTTCATAGG - Intergenic
1017350175 6:153431252-153431274 TTTTCATAAAAATATTTTATAGG - Intergenic
1017454326 6:154586896-154586918 TTTTAACTATAGTATTTTCTAGG + Intergenic
1017864740 6:158433311-158433333 TTTTGGCAAGAATACTTTAAAGG + Intronic
1017993289 6:159508942-159508964 TCTTAACATAAATATCTTATTGG - Intergenic
1018136706 6:160785521-160785543 TTTTCATAAAAATATTTTATAGG + Intergenic
1018883350 6:167907397-167907419 TGTTAGCAATAATATTTTAAGGG + Intronic
1019241982 6:170673379-170673401 TTTCAACAAATATATTGTATGGG - Intergenic
1019833893 7:3361260-3361282 TTTTAAAATGAATTTTTTAAGGG - Intronic
1020176245 7:5884437-5884459 TTTAGACAAATATATTTTATTGG + Intronic
1021157450 7:17229316-17229338 TTTCTGTAAGAATATTTTATTGG - Intergenic
1021268356 7:18553439-18553461 TTTTAAGAAGAAACTTTTAAAGG + Intronic
1021300763 7:18970403-18970425 TTTGAATAGGACTATTTTATAGG + Intronic
1021543371 7:21785414-21785436 ATTTAACAATATTATTTTAACGG - Intronic
1021793867 7:24233646-24233668 TTGACACAAGAATATTTTCTGGG - Intergenic
1021836645 7:24682966-24682988 TTTTTGCAAGAATAATTCATAGG + Intronic
1022119693 7:27296111-27296133 TTTTGGCAAGAATACTTTATGGG - Intergenic
1022382511 7:29873588-29873610 TTTTTAAAAGCATATTGTATGGG + Intronic
1022390492 7:29939640-29939662 TTTTAAAAACAAAATTTTATTGG - Intronic
1022589641 7:31649530-31649552 TGTTAACAAGAATACTTTAGAGG - Intronic
1022770146 7:33462140-33462162 ATTACACAAGAATGTTTTATTGG + Intronic
1022831590 7:34072826-34072848 TTTTAACAATAATTTTTAGTAGG + Intronic
1023422219 7:39992858-39992880 TTTTAGCCAGAATATTTAAGAGG + Intronic
1023775875 7:43606563-43606585 TTTTAACCAAAAAATTTTACTGG - Intronic
1023949558 7:44831934-44831956 TTTTCACAAAAATAATTCATAGG - Intronic
1024090124 7:45930896-45930918 TTTTAGCATAAAAATTTTATAGG + Intergenic
1024799028 7:53054525-53054547 TTTTTAAAAAAATATTATATAGG - Intergenic
1024952955 7:54883988-54884010 TGTGTACAAGAATGTTTTATAGG - Intergenic
1025245222 7:57312031-57312053 TTTTCACAAGCATATTTGAATGG + Intergenic
1026170291 7:67947966-67947988 TCTTTACAAGATTATTTTAGGGG - Intergenic
1027296730 7:76781215-76781237 TTTTGACAAGAACATTTTAATGG + Intergenic
1027568813 7:79835069-79835091 TTTTAGCAAGAATGATTTGTAGG - Intergenic
1027604270 7:80281460-80281482 TTGTATCAAGACTATTTTAGAGG + Intergenic
1027847904 7:83407447-83407469 ATATTACAAGAATATTTAATTGG + Intronic
1028012515 7:85665770-85665792 ATTTAAAAAGAAAATTTAATTGG + Intergenic
1028082266 7:86592534-86592556 AACTAAAAAGAATATTTTATAGG + Intergenic
1028120467 7:87051375-87051397 TACTTACAAAAATATTTTATAGG - Intronic
1028131478 7:87180479-87180501 TTTTAAAAAGAACATTACATAGG + Intronic
1028187022 7:87798817-87798839 TTTGGGCAAGAATATTTCATTGG + Intronic
1028363747 7:90002000-90002022 TTTTGACAAAAATGTTTAATAGG + Intergenic
1028430620 7:90743713-90743735 TTTTAACATTCATTTTTTATGGG + Intronic
1028648823 7:93127832-93127854 TTTTCCCAAAAATCTTTTATTGG - Intergenic
1028737420 7:94232927-94232949 TATCAAAAAGAATTTTTTATAGG + Intergenic
1029082579 7:97986588-97986610 TTTAGACAAATATATTTTATTGG - Intronic
1029153803 7:98500629-98500651 ATTTAGGAAGAATATTCTATGGG + Intergenic
1029783920 7:102766614-102766636 TTTAAAACAGAATCTTTTATTGG + Intronic
1030073477 7:105717434-105717456 TTTTTAAAAGATTATTTTAGAGG + Intronic
1030576836 7:111298374-111298396 TTTTAGCAACATTAATTTATCGG - Intronic
1030625850 7:111845349-111845371 TTTTAAAAATCATTTTTTATAGG - Intronic
1030812897 7:113997256-113997278 TTTTAAACTGAATAATTTATGGG - Intronic
1030980793 7:116182948-116182970 TTTGAACAAGAATATTCCATGGG + Intergenic
1031208204 7:118790029-118790051 TTTTAACTGGAATGTTTTAATGG - Intergenic
1031370118 7:120954888-120954910 CTTTAACAAAAATTTTTTAATGG + Intronic
1031475107 7:122211758-122211780 TTTTCACTAAAATATTCTATTGG + Intergenic
1031494077 7:122424978-122425000 TTTTAAAAAAATTATTTTTTTGG + Intronic
1031576384 7:123420073-123420095 TCTTAACCAAAATATTGTATTGG + Intergenic
1032528188 7:132596006-132596028 TCTTAAGAAATATATTTTATAGG + Intronic
1032735072 7:134684958-134684980 TTTTAACAAGAAAGTTTAAAAGG - Intergenic
1032738220 7:134712289-134712311 TTTTAAAAAGAAGATATTGTTGG - Intergenic
1032871779 7:135993682-135993704 CTTTGTCAATAATATTTTATAGG - Intergenic
1032926067 7:136606350-136606372 TTTTAGCAAGAATATTTCATAGG - Intergenic
1033157423 7:138968892-138968914 TATTAAGAAGAAAATATTATTGG - Intronic
1033669596 7:143478348-143478370 TTTTAATTAGAAAATTTTCTGGG + Exonic
1033854107 7:145535642-145535664 CTTTAACAAAAAAATTCTATTGG - Intergenic
1034370149 7:150588023-150588045 TTTTAAAAAGAATAAAATATTGG - Intergenic
1035479959 7:159174120-159174142 TTTTGAAAGGAATATTTTTTGGG + Intergenic
1035506134 8:134722-134744 TTTCAACAAATATATTGTATGGG + Intergenic
1035527079 8:322274-322296 TTTTGAAAATAAAATTTTATTGG + Intergenic
1035528971 8:336524-336546 ATTTTACAAGGATAGTTTATTGG - Intergenic
1036003535 8:4635550-4635572 TTTTAACAAGCATTTTTTAATGG + Intronic
1036018819 8:4818515-4818537 TATTAAGAATAATATTATATAGG + Intronic
1036105368 8:5832363-5832385 TTTTAAAAAGTGTATTTTAGTGG + Intergenic
1036272351 8:7318551-7318573 TTTTAAAAATCATATTTAATAGG + Intergenic
1036348997 8:7991791-7991813 TTTTAAAAATCATATTTAATAGG - Intergenic
1036844263 8:12152263-12152285 TTTTAAAAATCATATTTAATAGG - Intergenic
1036865635 8:12394585-12394607 TTTTAAAAATCATATTTAATAGG - Intergenic
1037061432 8:14515006-14515028 TTACATCAAGTATATTTTATAGG + Intronic
1037125404 8:15342079-15342101 TTTAAACAGTAATAATTTATTGG + Intergenic
1037157527 8:15722727-15722749 TTTTAACAAAAATTTTCCATTGG - Intronic
1037175582 8:15942982-15943004 TTTTAACATGCATATGTGATGGG + Intergenic
1038086423 8:24202392-24202414 TTTTAACAAGATATTTTTAAAGG - Intergenic
1038194824 8:25357676-25357698 TTTTAAAAAGTTTATTTTTTAGG - Intronic
1038287837 8:26221644-26221666 TTTTATAAATAAAATTTTATTGG - Intergenic
1038559975 8:28566965-28566987 TTTTAAGTAGAATAATTTATGGG - Exonic
1038853636 8:31306497-31306519 TTTTAAAAATAATATTTTGCTGG + Intergenic
1039162131 8:34634062-34634084 TTTTTATAAGACTATTTTAGTGG - Intergenic
1039295401 8:36145850-36145872 TTTTAAAAAAAGTATTTTTTTGG - Intergenic
1039666090 8:39530097-39530119 TTTTCAAAATAATATTTCATTGG - Intergenic
1039897204 8:41725027-41725049 TTTTAAAAAAAATGTTTTAGAGG + Intronic
1040437784 8:47409626-47409648 TATTTAGAAGAATATATTATTGG - Intronic
1040659941 8:49560089-49560111 TTTTAACACAAATATGTTTTTGG - Intergenic
1040714791 8:50237332-50237354 TTTTGGCAAGAATACTTTATTGG + Intronic
1041088911 8:54283473-54283495 TTTTAAAAAGAAAATTTTCCTGG - Intergenic
1041147191 8:54889580-54889602 TTTTATCCAGAATATTTTACAGG + Intergenic
1041297214 8:56369880-56369902 TTTCTACAAATATATTTTATTGG + Intergenic
1041360506 8:57048116-57048138 TTTTCATCAAAATATTTTATTGG + Intergenic
1041360687 8:57050408-57050430 TTTTCATCAAAATATTTTATTGG - Intergenic
1041386330 8:57308539-57308561 TTCTCACAAGAATGTTTTGTGGG - Intergenic
1041502870 8:58558275-58558297 TTTTAAAAAGTTTTTTTTATTGG + Intronic
1041859427 8:62495460-62495482 TTTTATCAAGAAATTTTTTTTGG + Intronic
1042055429 8:64759561-64759583 TATTAAAAAAAATAATTTATCGG - Intronic
1042132709 8:65604397-65604419 TTTTATCCAGATCATTTTATTGG - Exonic
1042266994 8:66918913-66918935 TTTCAACCAAAATATTTTAATGG - Intronic
1042301955 8:67293406-67293428 TTTTAATAACAAAGTTTTATTGG - Intronic
1042343844 8:67707949-67707971 TTTTCCCAAGGATCTTTTATTGG - Intronic
1042381467 8:68119207-68119229 CTTTAACAAGTATCTTTTCTGGG + Intronic
1042419995 8:68576123-68576145 GTGTAAAAAGAATATTTAATTGG - Intronic
1042741882 8:72058234-72058256 TTTTAAAAATCCTATTTTATTGG + Intronic
1044044317 8:87411877-87411899 TTTAAACAATAATATTGTTTAGG - Intronic
1044244217 8:89922338-89922360 TTTTAAAAAGAATTATATATGGG + Intronic
1044485749 8:92752106-92752128 TTGAAACAAGAATAGATTATTGG + Intergenic
1044711253 8:95060289-95060311 TTTTTATTAGAATATTTTAAAGG + Intronic
1044849492 8:96414392-96414414 TGTTAACTAGAATATTGTCTTGG - Intergenic
1044916743 8:97120552-97120574 TTCTAACAATGAGATTTTATTGG - Intronic
1045135636 8:99214181-99214203 TTTTATAAATAAAATTTTATTGG + Intronic
1045166711 8:99614631-99614653 TTTTAACCTGAGTATTTCATGGG + Intronic
1045168298 8:99631954-99631976 CTTTAGCTAGAATAATTTATTGG - Intronic
1045213462 8:100123296-100123318 TTATAATAAGAATATTAGATTGG + Intronic
1045428977 8:102095673-102095695 TTTTAACAAGAATACTGTCTTGG - Intronic
1045465373 8:102464624-102464646 TTTTAACAATAAAATATTTTAGG - Intergenic
1045659741 8:104425167-104425189 TTTTTAAAAGAATATTATAGAGG + Intronic
1045665888 8:104483910-104483932 TTTTAAAATAAACATTTTATAGG + Intergenic
1045819388 8:106318280-106318302 TTTTAAAAAGCATATTGTTTTGG - Intronic
1045943302 8:107764788-107764810 TTTAAACATGAATATTATATGGG + Intergenic
1046042358 8:108920993-108921015 TTATAGCAAAAATATTTTCTAGG - Intergenic
1046206468 8:111004874-111004896 TTTTTAAAATAATATTTTGTTGG + Intergenic
1046321804 8:112588214-112588236 TTTTAAAAATAATGATTTATGGG + Intronic
1046326633 8:112656535-112656557 TTTTAATAATAATTTTTCATAGG - Intronic
1046376536 8:113389420-113389442 TTTTTACATTAATATTTTGTGGG - Intronic
1046456496 8:114471187-114471209 TTTTTGCAAGAAACTTTTATAGG - Intergenic
1046538765 8:115551172-115551194 TATTAAGAAAAATAATTTATTGG - Intronic
1046577872 8:116054221-116054243 TGTTAATAATAATATTTTCTGGG + Intergenic
1048227985 8:132608737-132608759 TAGTAACCAGAATATTCTATAGG - Intronic
1048254106 8:132892411-132892433 TGAGAATAAGAATATTTTATTGG + Intronic
1048683980 8:136881003-136881025 TATAAACAAGAACATTTTATTGG + Intergenic
1048684860 8:136893213-136893235 TTTAACAATGAATATTTTATGGG + Intergenic
1049893668 9:94357-94379 TTTTAAAAATACTTTTTTATAGG - Intergenic
1050021640 9:1290795-1290817 TTTTAATAATAATATTATCTTGG + Intergenic
1050416448 9:5422320-5422342 TTTTAGCAAGAATCTTTTCTAGG - Intronic
1050544443 9:6697807-6697829 TTTTTACAAAAATATTTAACAGG + Intergenic
1050712249 9:8478344-8478366 TTTAAACAAGAAGATTTTTGTGG - Intronic
1050806478 9:9685741-9685763 TTTTAGCAGTAAAATTTTATAGG + Intronic
1050825374 9:9938822-9938844 TTTTATAAGGAAGATTTTATAGG - Intronic
1050840983 9:10148858-10148880 TTTAAATAAGCATTTTTTATTGG + Intronic
1050846544 9:10227964-10227986 TATTAACAAGAAAAATTTCTAGG - Intronic
1050879926 9:10686790-10686812 TATTCTCTAGAATATTTTATAGG + Intergenic
1051008625 9:12381678-12381700 TTTTAGCAAGAGTACTTTATAGG + Intergenic
1051203076 9:14651623-14651645 TTTATCCATGAATATTTTATTGG - Intronic
1051460846 9:17313076-17313098 TTTTAACTATAATATTTTGTTGG + Intronic
1051460984 9:17315019-17315041 TTACAACAATAATATTTTATGGG - Intronic
1051677766 9:19575607-19575629 TTTGAACTAGAAAATGTTATTGG - Intronic
1051974201 9:22929181-22929203 TTTTAAAAAGACTATTTTATAGG + Intergenic
1052161515 9:25266215-25266237 CTTTATCAATAAAATTTTATTGG + Intergenic
1052453763 9:28667247-28667269 TTTTAAAAATAATATTACATGGG - Intronic
1052580376 9:30347837-30347859 TTTTAAAAAAAATATTTTTGTGG + Intergenic
1052601053 9:30631505-30631527 TTTAAATAAAAATATTTTAAAGG + Intergenic
1052638922 9:31138841-31138863 TTTTAAAACGTTTATTTTATAGG - Intergenic
1052667150 9:31509302-31509324 TTTTAATAAGCATTATTTATAGG - Intergenic
1052702698 9:31957871-31957893 CTTTAAAAAGATTATTTTATTGG - Intergenic
1053377576 9:37620823-37620845 TCTTTACTATAATATTTTATTGG + Intronic
1053546755 9:39030994-39031016 TTTTAACCACAATACTGTATTGG + Intergenic
1053632795 9:39962871-39962893 TTTTATAAATAAAATTTTATAGG + Intergenic
1053734889 9:41094425-41094447 TTTTAAAAATACTTTTTTATAGG - Intergenic
1053772963 9:41500662-41500684 TTTTATAAATAAAATTTTATAGG - Intergenic
1053811072 9:41852648-41852670 TTTTAACCACAATACTGTATTGG + Intergenic
1054211093 9:62287826-62287848 TTTTATAAATAAAATTTTATAGG - Intergenic
1054313887 9:63561025-63561047 TTTTATAAATAAAATTTTATAGG + Intergenic
1054619522 9:67334791-67334813 TTTTAACCACAATACTGTATTGG - Intergenic
1054693493 9:68336972-68336994 TTTTAAAAATACTTTTTTATAGG + Intronic
1054704347 9:68447706-68447728 TTTTATAAACAATTTTTTATAGG + Intronic
1054953168 9:70876743-70876765 TTTTAAAAAGAATATTGTGCTGG + Intronic
1055066628 9:72125529-72125551 TCTTAAAAATAACATTTTATAGG + Intronic
1055134591 9:72813663-72813685 TTTTAACAAATAAATTTTATTGG - Intronic
1055645907 9:78361231-78361253 TTTGCACAAGAATATTTTGTGGG - Intergenic
1055677749 9:78682582-78682604 TTTTTGCAAGAATGTTTTATAGG + Intergenic
1055711470 9:79066718-79066740 TTTTACAAACAATATTTTCTTGG - Intergenic
1055812723 9:80168652-80168674 TTTTAAAAGGAATCTTTTTTGGG + Intergenic
1056082270 9:83107832-83107854 TTTAAACAACAAGAGTTTATTGG - Intergenic
1056337827 9:85593177-85593199 TTTTGGCAAGAATACTTAATAGG - Intronic
1057432985 9:95011953-95011975 TTTTAAAAAGAATCTTTGAATGG + Intronic
1057434155 9:95023919-95023941 TTTTGAAAAGAAGTTTTTATAGG + Intronic
1057737350 9:97676339-97676361 TTTTACAAAGAAAATTATATTGG + Intronic
1057757718 9:97851503-97851525 TTTTAACTGGATTATATTATAGG - Intergenic
1058137609 9:101324279-101324301 CTTGAACAAGAAAATTTTGTTGG - Exonic
1058203823 9:102076799-102076821 TCTGAAAAAAAATATTTTATTGG + Intergenic
1058270319 9:102964918-102964940 TTTTTAAAACAAGATTTTATTGG + Intergenic
1058273001 9:102998634-102998656 TTTTAGTAAGAATCATTTATAGG - Intronic
1058413064 9:104755325-104755347 TTTTAAAAATAATATTATTTGGG + Intronic
1058712245 9:107690246-107690268 TTTAAACAAGAAAATTAAATGGG + Intergenic
1058776413 9:108288413-108288435 TTTTGGCAAGAATATATCATAGG + Intergenic
1059205617 9:112461968-112461990 TCTTATCAAGTATATTTTATAGG + Intronic
1059519192 9:114923970-114923992 TTTTAGTAAGAATAGTATATAGG - Intronic
1059590517 9:115654959-115654981 TTTTTAAAACAATATTTTAAAGG + Intergenic
1059812243 9:117868243-117868265 TTTTGAAAAGAATATTTATTGGG + Intergenic
1060365833 9:123012545-123012567 TTTTAAAAATAAAATTTTAGGGG + Intronic
1060609095 9:124945253-124945275 TATTAAAAAGAATTTTTTTTAGG + Intronic
1203422197 Un_GL000195v1:3642-3664 TTTTAAAAATAATAAATTATAGG + Intergenic
1203718425 Un_KI270742v1:178418-178440 GATTAACATGAATATTATATTGG + Intergenic
1203602173 Un_KI270748v1:22613-22635 TTTCAACAAATATATTGTATGGG - Intergenic
1203650049 Un_KI270751v1:108215-108237 TTTTAATAAGACTATTCTAATGG - Intergenic
1185913168 X:4004860-4004882 TTTTAAAAAGAAGGTTTAATTGG - Intergenic
1185955820 X:4487846-4487868 TTTAAAAAAGAAAGTTTTATTGG + Intergenic
1185982717 X:4797367-4797389 TTTTATCAAAAATACTTTATAGG - Intergenic
1186037264 X:5438094-5438116 TTTTAAAAATTATATTTTGTCGG + Intergenic
1186540168 X:10392368-10392390 TTTTATAAATAAAATTTTATTGG - Intergenic
1186605252 X:11083190-11083212 TTTTATAAACAAAATTTTATTGG - Intergenic
1186623422 X:11265765-11265787 TTTTAAAAAAATTATTTTTTTGG + Intronic
1186951466 X:14630189-14630211 TTTTAAAAAGATATTTTTATTGG + Intronic
1187075332 X:15929112-15929134 TTTGAAAAAAAATATTTTAATGG - Intergenic
1187573544 X:20530426-20530448 TACCAAAAAGAATATTTTATTGG - Intergenic
1187874442 X:23792450-23792472 TTTGGGCAAGAATATTTCATAGG + Intergenic
1187925030 X:24242141-24242163 TATTAACAAGAATATTTGATTGG + Intergenic
1187980189 X:24748238-24748260 TTTCTACAGTAATATTTTATAGG - Intronic
1188138156 X:26514944-26514966 TTCAACCAAGAATATTTTAATGG + Intergenic
1188191625 X:27178319-27178341 CTTTAAAAACAATACTTTATGGG + Intergenic
1188198785 X:27274273-27274295 TTTTACCTAGAATGTTTTAATGG - Intergenic
1188315392 X:28667269-28667291 TTTTACAAAGATTATTTTACAGG - Intronic
1188360842 X:29251405-29251427 TTTTAAGAAAAATAATATATGGG + Intronic
1188377522 X:29450475-29450497 TTTTGTAAAGAAAATTTTATTGG - Intronic
1188542766 X:31267691-31267713 TTTCTAATAGAATATTTTATTGG + Intronic
1189063338 X:37778561-37778583 TTTTAACAAAAATGTTTTAAAGG - Intronic
1189211073 X:39283283-39283305 TTTTTACAAGAATAGTTCATAGG + Intergenic
1189557128 X:42156540-42156562 GTTTAACAAAAATATTTTAGGGG - Intergenic
1189613159 X:42758596-42758618 TTTTAAAAAAAATATTACATTGG + Intergenic
1189644162 X:43108559-43108581 TTTTTACAATAATTTTATATGGG + Intergenic
1190516230 X:51225998-51226020 CTTCATCAAGAATATTTTATAGG + Intergenic
1190566940 X:51740513-51740535 TTTTAACAAGAATACTTCAAGGG - Intergenic
1190754110 X:53386078-53386100 TTTTGGCAAGAACATTTCATTGG - Intronic
1190754912 X:53393132-53393154 TTTTGGCAAGAATATATCATAGG - Intronic
1191776475 X:64820149-64820171 TTTTAAAAAGAATTTTCTAATGG - Intergenic
1191798183 X:65045960-65045982 TGTTAAGAGGAATATTTTCTTGG + Intergenic
1192134560 X:68585017-68585039 TTTTGTCAAGAATACTTCATTGG - Intergenic
1192574611 X:72233199-72233221 TTTTGGCATGAATACTTTATAGG - Intronic
1192703718 X:73505337-73505359 TTTTTAAAAAAATATTTTGTTGG - Intergenic
1192980419 X:76333841-76333863 TATTAACAAAAATTTTTTCTTGG + Intergenic
1193460212 X:81782150-81782172 TTTTAACAAGATTATTTTATAGG + Intergenic
1193517130 X:82479592-82479614 TTTTATTAAAAATATTTCATGGG + Intergenic
1193732105 X:85113983-85114005 TTTTCACAAGAGACTTTTATTGG + Intergenic
1194031095 X:88816396-88816418 TTCAAATAACAATATTTTATTGG - Intergenic
1194060671 X:89192725-89192747 TCTTAACAAAAATATTTCAAGGG - Intergenic
1194304577 X:92227252-92227274 TTAAAACTAGTATATTTTATAGG - Intronic
1194333834 X:92619537-92619559 TTTTATCAACAATATAGTATTGG - Exonic
1194719633 X:97325098-97325120 GTTTAAGAAAAATAATTTATTGG - Intronic
1195039905 X:101004460-101004482 TTTTGACAAGAATACTTAAGTGG - Intergenic
1195200102 X:102541085-102541107 TTTTACCAACAAGATTTGATAGG + Intergenic
1195201776 X:102557975-102557997 GTTTGGCAAGAATATTTCATAGG + Intergenic
1195240912 X:102950942-102950964 TTTTTAAAAGTATATTTTCTGGG - Intergenic
1195309563 X:103618139-103618161 TTTTAACAACTGTCTTTTATTGG - Intronic
1195696058 X:107668429-107668451 TTTTAAAAAAAATTTTTTACAGG - Intergenic
1196185461 X:112740234-112740256 TTTTTATAGTAATATTTTATTGG - Intergenic
1196265896 X:113646339-113646361 TTTTATAAATAATATTTTATTGG + Intergenic
1196319089 X:114267681-114267703 CTTTTAAAAGAATATTTTTTAGG + Intergenic
1196611601 X:117720840-117720862 TTTCGACAAGATTATATTATAGG - Intergenic
1197137111 X:123074357-123074379 TTTTAAAAAGAAATTTTTAAGGG + Intergenic
1197183968 X:123565809-123565831 GTTTAACAAGAATACTTTATTGG - Intergenic
1197358805 X:125471755-125471777 TTTTAACATGAATTTTTGAGGGG + Intergenic
1197458356 X:126706589-126706611 TACAAACAAGAATATTTTAATGG - Intergenic
1197529672 X:127607257-127607279 TTGGAACAAGAATTTTTTCTAGG - Intergenic
1197592403 X:128424519-128424541 TTTTTGCAAGAATATTACATAGG + Intergenic
1197661886 X:129182477-129182499 TTTTCACAAGAATACTTGATAGG - Intergenic
1198264246 X:134994748-134994770 ATTTTACAAGAAAATTTTAAAGG - Intergenic
1198527491 X:137516569-137516591 TTTTAAAAGGGAAATTTTATGGG - Intergenic
1198699899 X:139385255-139385277 TTTCAACAAGGAAATTTTAGGGG - Intergenic
1198915440 X:141666057-141666079 TTTTATAAATAATATTTTATTGG + Intronic
1198999619 X:142619212-142619234 TTTCAAAAATAATATTTTCTAGG + Intergenic
1199084938 X:143617493-143617515 TTTGGACAACAAAATTTTATTGG + Intergenic
1199179118 X:144832756-144832778 TTTTGGCAAGATTATTTTACAGG - Intergenic
1199554853 X:149095721-149095743 TGTTGAGAAGAATATTTTCTAGG + Intergenic
1199810954 X:151347782-151347804 TTCTTGCAAGAATATTTCATAGG - Intergenic
1200170748 X:154072455-154072477 TTTGGGCAAGAATATTTCATAGG - Intronic
1200642519 Y:5738539-5738561 TTTTATCAACAATATAGTATTGG - Intronic
1201185247 Y:11395451-11395473 TTTAAAAAGGAATATTTTAAAGG - Intergenic
1201563682 Y:15344381-15344403 TTTTACTGAGAATATTTTCTAGG - Intergenic
1201577568 Y:15477399-15477421 TTTTAAAAAAAAAATTTTTTTGG - Intergenic