ID: 995585155

View in Genome Browser
Species Human (GRCh38)
Location 5:113641253-113641275
Sequence CCTGGAGTTCTGACACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995585155_995585161 7 Left 995585155 5:113641253-113641275 CCTTGGGGTGTCAGAACTCCAGG No data
Right 995585161 5:113641283-113641305 GCCTTTGCAGTCCAGGACTTGGG No data
995585155_995585164 18 Left 995585155 5:113641253-113641275 CCTTGGGGTGTCAGAACTCCAGG No data
Right 995585164 5:113641294-113641316 CCAGGACTTGGGTAGCCTCCTGG No data
995585155_995585159 0 Left 995585155 5:113641253-113641275 CCTTGGGGTGTCAGAACTCCAGG No data
Right 995585159 5:113641276-113641298 CTGTCTGGCCTTTGCAGTCCAGG No data
995585155_995585160 6 Left 995585155 5:113641253-113641275 CCTTGGGGTGTCAGAACTCCAGG No data
Right 995585160 5:113641282-113641304 GGCCTTTGCAGTCCAGGACTTGG No data
995585155_995585165 27 Left 995585155 5:113641253-113641275 CCTTGGGGTGTCAGAACTCCAGG No data
Right 995585165 5:113641303-113641325 GGGTAGCCTCCTGGATACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995585155 Original CRISPR CCTGGAGTTCTGACACCCCA AGG (reversed) Intergenic
No off target data available for this crispr